Beefy Boxes and Bandwidth Generously Provided by pair Networks RobOMonk
Think about Loose Coupling
 
PerlMonks  

Comment on

( #3333=superdoc: print w/ replies, xml ) Need Help??

Hi

Not as polished as the example above, but outputs the same results

use strict; use warnings; my @processed; while (my $a_line = <DATA>) { chomp $a_line; if ($a_line =~ /^>/) { #this is a header, keep as is push @processed, $a_line; } else { # This is a dna seq, process #' Translate each three-base codon into amino acid, # and append to a protein my $protein = ''; my $len = length($a_line) -2; for(my $i=0; $i < $len ; $i += 3) { my $codon = substr($a_line, $i,3); $protein .= codon2aa($codon); } push @processed, $protein; } } #now display what we have processed print $_, "\n" for @processed; #' codon2aa #' #' A subroutine to translate a DNA 3-character codon to an amino acid sub codon2aa { my($codon) = @_; if ( $codon =~ /GC./i) { return 'A' } # Alanine elsif ( $codon =~ /TG[TC]/i) { return 'C' } # Cysteine elsif ( $codon =~ /GA[TC]/i) { return 'D' } # Aspartic Acid elsif ( $codon =~ /GA[AG]/i) { return 'E' } # Glutamic Acid elsif ( $codon =~ /TT[TC]/i) { return 'F' } # Phenylalanine elsif ( $codon =~ /GG./i) { return 'G' } # Glycine elsif ( $codon =~ /CA[TC]/i) { return 'H' } # Histidine elsif ( $codon =~ /AT[TCA]/i) { return 'I' } # Isoleucine elsif ( $codon =~ /AA[AG]/i) { return 'K' } # Lysine elsif ( $codon =~ /TT[AG]|CT./i) { return 'L' } # Leucine elsif ( $codon =~ /ATG/i) { return 'M' } # Methionine elsif ( $codon =~ /AA[TC]/i) { return 'N' } # Asparagine elsif ( $codon =~ /CC./i) { return 'P' } # Proline elsif ( $codon =~ /CA[AG]/i) { return 'Q' } # Glutamine elsif ( $codon =~ /CG.|AG[AG]/i) { return 'R' } # Arginine elsif ( $codon =~ /TC.|AG[TC]/i) { return 'S' } # Serine elsif ( $codon =~ /AC./i) { return 'T' } # Threonine elsif ( $codon =~ /GT./i) { return 'V' } # Valine elsif ( $codon =~ /TGG/i) { return 'W' } # Tryptophan elsif ( $codon =~ /TA[TC]/i) { return 'Y' } # Tyrosine elsif ( $codon =~ /TA[AG]|TGA/i) { return '_' } # Stop else { return '*'; } } __DATA__ >M01096:4:000000000-A23M1:1:1101:15974:1529 1:N:0:16 GTTACTGAGTGTGGTTGGCAGACTGCTGGTTGCCGTATGTAT >M01096:4:000000000-A23M1:1:1101:16525:1548 1:N:0:16 CTTTCTCATTGTGATGTTAAGGATTGGATGTGCTGGCTTCTG >M01096:4:000000000-A23M1:1:1101:13838:1554 1:N:0:16 GCTTGGACTTGTGTTGAGATTGATGGTCATTTCTCTATGAAT

Output

>M01096:4:000000000-A23M1:1:1101:15974:1529 1:N:0:16 VTECGWQTAGCRMY >M01096:4:000000000-A23M1:1:1101:16525:1548 1:N:0:16 LSHCDVKDWMCWLL >M01096:4:000000000-A23M1:1:1101:13838:1554 1:N:0:16 AWTCVEIDGHFSMN

Arnaud


In reply to Re: How do I stop appending data by arnaud99
in thread How do I stop appending data by 4pt8secs

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post; it's "PerlMonks-approved HTML":



  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • Outside of code tags, you may need to use entities for some characters:
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.
  • Log In?
    Username:
    Password:

    What's my password?
    Create A New User
    Chatterbox?
    and the web crawler heard nothing...

    How do I use this? | Other CB clients
    Other Users?
    Others making s'mores by the fire in the courtyard of the Monastery: (6)
    As of 2013-06-18 03:39 GMT
    Sections?
    Information?
    Find Nodes?
    Leftovers?
      Voting Booth?

      How many continents have you visited?









      Results (594 votes), past polls