Beefy Boxes and Bandwidth Generously Provided by pair Networks
laziness, impatience, and hubris
 
PerlMonks  

Comment on

( #3333=superdoc: print w/ replies, xml ) Need Help??

Hi

Not as polished as the example above, but outputs the same results

use strict; use warnings; my @processed; while (my $a_line = <DATA>) { chomp $a_line; if ($a_line =~ /^>/) { #this is a header, keep as is push @processed, $a_line; } else { # This is a dna seq, process #' Translate each three-base codon into amino acid, # and append to a protein my $protein = ''; my $len = length($a_line) -2; for(my $i=0; $i < $len ; $i += 3) { my $codon = substr($a_line, $i,3); $protein .= codon2aa($codon); } push @processed, $protein; } } #now display what we have processed print $_, "\n" for @processed; #' codon2aa #' #' A subroutine to translate a DNA 3-character codon to an amino acid sub codon2aa { my($codon) = @_; if ( $codon =~ /GC./i) { return 'A' } # Alanine elsif ( $codon =~ /TG[TC]/i) { return 'C' } # Cysteine elsif ( $codon =~ /GA[TC]/i) { return 'D' } # Aspartic Acid elsif ( $codon =~ /GA[AG]/i) { return 'E' } # Glutamic Acid elsif ( $codon =~ /TT[TC]/i) { return 'F' } # Phenylalanine elsif ( $codon =~ /GG./i) { return 'G' } # Glycine elsif ( $codon =~ /CA[TC]/i) { return 'H' } # Histidine elsif ( $codon =~ /AT[TCA]/i) { return 'I' } # Isoleucine elsif ( $codon =~ /AA[AG]/i) { return 'K' } # Lysine elsif ( $codon =~ /TT[AG]|CT./i) { return 'L' } # Leucine elsif ( $codon =~ /ATG/i) { return 'M' } # Methionine elsif ( $codon =~ /AA[TC]/i) { return 'N' } # Asparagine elsif ( $codon =~ /CC./i) { return 'P' } # Proline elsif ( $codon =~ /CA[AG]/i) { return 'Q' } # Glutamine elsif ( $codon =~ /CG.|AG[AG]/i) { return 'R' } # Arginine elsif ( $codon =~ /TC.|AG[TC]/i) { return 'S' } # Serine elsif ( $codon =~ /AC./i) { return 'T' } # Threonine elsif ( $codon =~ /GT./i) { return 'V' } # Valine elsif ( $codon =~ /TGG/i) { return 'W' } # Tryptophan elsif ( $codon =~ /TA[TC]/i) { return 'Y' } # Tyrosine elsif ( $codon =~ /TA[AG]|TGA/i) { return '_' } # Stop else { return '*'; } } __DATA__ >M01096:4:000000000-A23M1:1:1101:15974:1529 1:N:0:16 GTTACTGAGTGTGGTTGGCAGACTGCTGGTTGCCGTATGTAT >M01096:4:000000000-A23M1:1:1101:16525:1548 1:N:0:16 CTTTCTCATTGTGATGTTAAGGATTGGATGTGCTGGCTTCTG >M01096:4:000000000-A23M1:1:1101:13838:1554 1:N:0:16 GCTTGGACTTGTGTTGAGATTGATGGTCATTTCTCTATGAAT

Output

>M01096:4:000000000-A23M1:1:1101:15974:1529 1:N:0:16 VTECGWQTAGCRMY >M01096:4:000000000-A23M1:1:1101:16525:1548 1:N:0:16 LSHCDVKDWMCWLL >M01096:4:000000000-A23M1:1:1101:13838:1554 1:N:0:16 AWTCVEIDGHFSMN

Arnaud


In reply to Re: How do I stop appending data by arnaud99
in thread How do I stop appending data by 4pt8secs

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post; it's "PerlMonks-approved HTML":



  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.
  • Log In?
    Username:
    Password:

    What's my password?
    Create A New User
    Chatterbox?
    and the web crawler heard nothing...

    How do I use this? | Other CB clients
    Other Users?
    Others surveying the Monastery: (3)
    As of 2015-07-06 04:11 GMT
    Sections?
    Information?
    Find Nodes?
    Leftovers?
      Voting Booth?

      The top three priorities of my open tasks are (in descending order of likelihood to be worked on) ...









      Results (70 votes), past polls