Beefy Boxes and Bandwidth Generously Provided by pair Networks
laziness, impatience, and hubris
 
PerlMonks  

Comment on

( #3333=superdoc: print w/ replies, xml ) Need Help??

Check this code : This code gives me output starting from range: 39761 .. 39960 rather than 0-200. And one more thing it shows G+C and GC percentage as such as i given in the code, i want the total of G+C e.g. 30+40= 70 rather than 30+40.

#! perl -slw use strict; my $dna = do{ local $/; <DATA> }; $dna =~ tr[\n][]d; my %counts; ++$counts{ substr $dna, $_, 1 } for 0 ..199; for my $offset ( 0 .. length( $dna )-200 ) { printf "range: %d .. %d A:%d C:%d ($counts{C}+$counts{G}) GC*100 +/$counts{A}+$counts{T}+$counts{G}+$counts{C} G:%d T:%d\n", $offset, $ +offset+199, @counts{ qw[ A C G T ] }; --$counts{ substr $dna, $offset, 1 }; ++$counts{ substr $dna, $offset+200, 1 }; } __DATA__ GATCTAATGGAATCCTCAATAGCTCAATCGATTCATAAGGGCTTTGAGAAGGAACGTTGGGAAAGCAAAG GGTAAGCGGTCCCATCACATTCCACAATTAAAATTACCAAAATCGCATTCAAGGTCTCACATAATCAAAT TAAAGAGTCGATTGTAAATGCATAGATACATCATTAAATCTACAACACAGTTGACAAGAACATACTAAAA CGTCAAAATTGTTTCAAAACTAAAAAAACCAAGCAGCATTTTGTTTTTGAAAATATACCGATCGATAAAA CAAATATGTACAAATAGCAATGTATTTATCCAGCGGACCTAACTTTCGCAAATAATATCGCATATTGGCA AAATGCCAAGCCTAACCCAGACAAGACTCTCGCAATGAAATCGGAAAACAATAGCACTATGATGTATATT TCGTTCAGTTTTTGGTGAAAGCGAAGGTTTCATTAACGATAATCGCAAGGGCTAGCGAGCCTTTGGTGAA AAGCTGTCCTGTGACACGTTGACAATTCAATATATTACACTACATATTTTTACATATTATTTATATAATA TATAAATTCTTATTTCAATATGTACGAGTGTTTTGCGATACAAAATATCCCACCCGTTCCCAGCGCATAT ACGAGCACATTTCAGGGCATTTTATGAGACGCTCGCAAAAGGCTTTTATGTTGATCCGCTGGGTATTTAT AAATGCAAATAAAATATACATGGAATTGCCTTCATTGCAAGAAAACAAATTTTTAAAATGATATATTTTC CTCTAAACTGTCCTAACTGGCTGACTGATTGGTTAATAAACGCACAGAGTTAGAAAGCTGACACTTGAAC TTTAAGTAATTTATATGATGAGGTCATGGAAATTTTACCGACATGTATGGTAAATTCATGAAAAACGTGT ACAAATTGTTTGGTAATTATCCGATCGGCTCTAAACTTATTTTCGAAATCGACTAATTCTGGAATTAAAG GAAGTACGTGTACATTTACATGCACCAGACACAGCTGTGTTATACCCACTAATATATATCACTCATGCAA AACTTTATTTAATAATTATTTATAATAGTTTGTTATATATAATATTGATGTGTCTATGTGTGGGTGAGTT TCTCGTAATTTATGTTATTCGATGTTGAAATGGGCTTACGAATTGATAAGCGTAATTAGGCTTGGTACGT AGGTTCATCCTCTGTTCCTTGACTCATTTCATATTTTAAAATTCAATATGCCGCTCATATTTTCTATTTC CATATTTCTGTGAAAATTTAGGATAAACGCTGCTTTGAATCCAGCCGCATTAAACAATGCCGCCCAGGCG CTAAACACGGCAGCTCTCAACCCAGCGGGGCTGCTGAGCGGCAAGAAAGATCAAGTCAATTTTTATGTAC CGAAGCTACCAAGGCGCACAGCTGCACCTGCGGCAGCCGCTGATGAAATGAGGTTTTTAAATGATGCACC TACCTAAGAAACTTACGTAGCCACACCCTGAAAATATGTTCTCTTTGCATTTTGTTGTTTTCTGCCAATT ATCATGCATTGCATTACCCAAGAGTTGATTTATCTAGAGCTTTAGCAAGCATAATTCATATTTATGCATT TCACTATAAAATTGAAATACATGCAAATGTAAATTAATGTTCATTTTATATGTAATGCTAACGATTAGAA ATTTAATAATTATAGCTTTAATAATACTACTTATAATTACTGCCACCTCCACAACTATCACCACCACGAC TACCGATGAAGAGTTGCTTCCTTAATAGTACCATATACATACATACATACATATGCGCATATCCGAACTG ACATACAAACATATATATGTATATATTTTATGGTTCTTTTTATTTTCTGTTTAGCCACATTATGTGTCGT TCGAGAGCGAAACACTAAATTTATATATTCCTTGTTCCGGAAAAATGGGATTTATATTAATTATACAAAT TTGGAGTTCCCTTGAAATTCTTTATCGTGAGTTCCAGTAATATGGCAGATATGCATGTACTTAGTGCAAT TACAATAAAAATCTTCGGCTTCATATGGTGCAAGCTTATTGCCTGACTAGCAATTTCCCTGTGCATATTA TTCATTTGCATTAACTTCATTCAAACATTAACTTAACACACAAAAACAGCCGTACTAACACGAAAGGTTT GCCCCCTTATACTAACTACTCTAGGTCCAATATATCAACTACGTTTATTGTCTAATAAGCTATATTCCAT TAAATACATTTGCTAAGACTATTTTGCTGTTTTCTTTTCATGAAGCGGAAGGAGATATCCAACATGTGGA ATATATATAATCTGCATTTTTTTTTTATACTAGAACCTAGATCTTATATTTTACTTTTTATTGCCTTTAG CTCTTTTAATCACAGAGATATGATTATAAAAGTGCGACCAAGATTCGATACATTGATTTGAGGATAAAAG GAGTTATCCAAAAACAAAAAAATTTACGTACGGTATTCGAGCATCTTATAGTTATAGATATCACACGCAG GTAGAGACTGGCGGTGGTGCCTTTTTTTATGAATTCGGGGTTTCCTTGGGACATCTGCATTTGTGTTTAC AACGATATTATTATAAGCCTATAAGCTTAAATGATATTTGATTTATATACGCTTTAATTAATATAAAATA TAAGTTCATAACAGAATGTGGCATTATAAATTTCAGTAAATAAATATTAGCTATTTATATTCTTCACATT GTGCGTGCGCTTATTACCTATAATCTTTGTCAATATAAAAATCACCACAATGGCAATACTACACCTTTAA TCAGTATTAGCAATTATGTAGAAAAGCATCCCTTTCAAATTTTTGTAGTTGCATTGCTTGCTTGAAGTTA ATCGCCGATATTTGTAATTATATTATTATTCTATTGGTTGCATTATGCTCAAATAAAATAGATGCTGAGA ATTCAATTTCGATGGATATTATGTGAGCGTTAATGGATGGGCGAATTGAATCGCTAATTAAATTATATTT CCAAGCAAAATATATGGAATTCAATTTTTTTATAATCTTAATAGTCAAGCTCCCTTATCTTTTTATAAGC ATTGCAAATATTTTTCCAAATAACCATTCCTTGTACTTTTCGAGGGTAGTTATATTAAAGACCGTATATT ATTCACTTATTTTGGGCAAATCTTTAAAGAATTATTTTCGTATACCGATACTTTTAACTTTATAAATAAT ACTAAATTATTTAAAGTAAAGATGAAAATCCCTTTATTAATACAATAGTTTAAAGGGCTTTGACCTCACT GAATGTTATTTGAAGTTCTTCCATTCTTTTTTATAAATTTCCCCTGAATCAACAGGAATTTCTCGAGGAG GGTCGATATTTGTGAACATGTCTTCCCAATTATCATGCTGAGCTTATGTATTGAAAGACAAACGTCCTTT TATTCGCGTTTTTTTTTTTGCGATGCATCTTAAGATACATGTCTTATACCGTTGGCTTCTTGAAAAATAG GTTGCGAACCAAGTTCGTTTTCTAAAAACTCAACCAAAACTCCATCCAAAATGTTGACATAATCTGTCGA CTTTATTTCGGACGTGATTGTGCATATGGTCGCAATTGTAACCTAGCTTTCTGATAATAAAATTAATAAT AATTTATATGATTATGTACGTATATAAATATGTATAGTGTATAGAGAGATTGCTCAAGTAAAATATATCG TTACATGAAATCTAATAGTAAATATTAATAATAGATTATAAATAATTTGATTGTCTTCCCCATTTTTTAT ACGCACAGAAATGGTTGTGCAACTTCCGAAGACCTTTTCTGGAAACTAGACGCACTGCAATCCTTTATTA GAGATCTGCATTGGCCAGATGCCGAGTTTCGTCAGCATTTGGAGCAGAGACTTAAGATGATGGCTGTTGA TATGATTGAGCAGTGCATACAGCGCACAGACTCTTCCTTTCAGTCTTGGTTAAAAAAAAATGTTGCCTTT ATATCGACCGATTATATTATACCATCAGAGATGTGCGCTATGGTAAATGTGATATTAGATGCTAAAAACC AAAGCTTTAAATTAACCACCATCGATGGTATCGATCTGGTAAGTAAATTTTTATGATGTTGTATGATGTA TGTTCTTAAATATAAACTACTACTCAATAACGACTAACCTACTTATACACTAAATTAATGATTATTATAT CAAAATAAAAAAACAGTACAAATTCCACGCAAAAATCGATGATCAAATAGACAAAGCGAATGTAGCGATG ACACAAGGATTAAGTGGCAAACTTATGTCAGTGCTAGAGTCGACTTTGTCGAAGTTGGCGCGTTACGATG AAGGTAGCCTCATTGGCTCGATTCTTAGTTTTACAAACGTGTCCAGCTCAGGAAAAGATCTGGGACAAGG CTATGTGAATTTTTTTCGTAACAATATGGATCAAATACGCGGCAAGATAGGTGATGACCTATGGACACTG AACTTCTTTGAGCAGTGGTACTCTCAGCAAATAAGTATGCTCTCCAGCTGGCTATCAGAACGTTTGGACC ACGCCCTACACTATGCACAGGTCACGTCTATCTCTCATATTATAAAGGTAATACTAAAACGCTACTACTT CGTACAAAACAAGATAAGACTGCAACCTTACTCATTTCTGGTCGACTCATTAGGGGCCCAAATGACGAAA ATAATTTGAACAAAGTGGAATCTGTCTCATTTTATTCAAATGCGTATCAATTTAACACTAGCCCTTTACA CTTTAGTTCTTTCTAAATTGTTAATATTTGAAGTAGTTTAATTTGTAAGTATTCAAAACTATTACATTTA TTTTTGCAGTTTCCTCGATATAAACAAAATGTTGCCTGTCGCTTTTGAAGCTGAAGAGTAGCAGCATTTT GTAATGAAAGCTTACAATCTGGCAGCAACCCAAAAATCCAGCTTTTTAGTTATATTTAACTAATATAATC ATATTATACTGTTCAATAATAAGTCATCCATAGTCAGCCAAATTTCCGAGCTTTATTCCTTAAAAATAAT TACCGTCAGTAGACTTCAATATGCAAAATCTCTTTTAATGCTGTCGATATTTTTTTAAATTAAGGCTACA AACCAATTCAAATATACATAATTTTTTTGTAACTTTTAATAAAATCTCAATCGAAACCAATTTTTTGCTC AATAAGTATAAAAAGCTTACGCCCCATTTTGGTAAATACCTACTTTGTATTTACAATTTAAACAAGTAAA TGGTTCTAGTCGGGAGCTCCTTCTACCTGTTACACACATTTACATTTTGCACAAATAAAATATACCCTTT TTACCCATTTTTAATGGGTTCAGGGTATAAAAAAAATTTGGGATTTTGTAACCAGATTCATTAACAGGCG TATGAGCTAAATGTAAAAAAGCCCAATCATAATATATTATACTGTTTTTTAATAACGATACCTGCTATAC GCGAAGGAAATCTTATTTGTCCGCTAAGCCAGCTATGCCCCGATTCACAGAGTCGTAATAAGCCTTTATA GTTCAATGGAATATGGTAGTCAGTCATAAATAAGTAAAATAATTTAATTGTTTGTGGGCATAAAGAAAAT GCCTCCTGCTGCCTGCTGTATAATCAGATATGCAGAAAACGTATATAAGCTTTTTTCATCCATTACATGT TTTTCAGGATTCTTTATAGCTATATTTTTTTAATTTGATTTAAAAAAATTCAATATTTGGCTTTCCCAAT ACTTTGCAAAAGTTATGTTGCATCAGAAATCCAATATCCAATTTAGTTCTGTTAATGAGAACTTTATCTA ATAAAATAGTTGCTACAAATATTGTTTACATTGTATCAACAGAAAATTTATTCAGACTTTGAGCTTCAAG GTGTTCTCGAGGACAAGCTAAATTCTAAAGCATATCAGACAGTTATACAACGAATGACTGCTGAAGAGGC AACCTGTGCGCTGAGCATGCCAGAAGGCACCGATGGTGATGAGTAAGTAGGGTCGATGGACATAAAAGTA CTTTGCTAATTATTGCTCTATTAATCAACAAAGAAATTGTGACGATATCCGCAACGGTGACGAAGAGGAT GGTGGAGATGATTCTGGCGCTCACGCAGCGCGGAGCCTCCCAAAGCCAAAGACGGGAGCTGCCCAAGCTG CGGCTGTCACCAACGTAGTCGCTGGTCGGGTTGGTAATTTACTTGGTAAAGGCATTGGCGGACTTAGCTC AAAGCTGGGAAGCGGCGGTTGGTTTTGAATTTTAAAGGAAACAAAGTGGCCATCCAGGATGAAATCACAT ATTGACGTCCAACTTCTGATGGCAGCTTCGTAGCTATTCTGAGCCAAGTCCACTGTCGTATCAATAATTC TTCGACAACAATAATAATAGATATCAATAATACAATAGTCCGTGAATGTAAAGAAGATCTTTAAACACTA GCTTTTAAATACAAATATTATTAAAAAAAAACTCGATTATGGAGAGCGTTGTAGCGGACATATTTAATTA TTTTATATAAAAAATCAATAATTTCGATTTGAAAGGACAGTTCTTTCTGGTAAGAATTATAAGCACTATC ATTATCTAAAATAATTTGATCTTAATCGAGTTAAAAATCAATACTTACATTTGCAAAACATAATTACCTC TTTAATAATATTACACGATAATTAATGAAAACTATTATTAATTATTAATTATTGGTACATGCATATTTCT TCATCAGACGCGTTGCTGGTATGTACAAGGAGTACGTAAAAATAAACCAATCAATAAATTGTACACTTTA AAATATATTTTCCACTCTTCCAATTAATAAAAGCTTATTATGTGCAATGTTTAGATTAAGGCCTTAAGAA ATATCTCAAAGTGTATTTTATTTGTTCATCAGAATATTTGTTTTATGCTTGCGAAGGTAGTCACAATTTG TAGATGTTTATATTTTATTTAAATTAGCAAACCGAACAACCATACATTAAAACAAGTCTCTTAATTTTGA AGCTATTTAATAAAACCTTTTTTTGCTGCAGATAATAAATAAATATGTTAAAGTAGACCGAATCGGACTA CTATTTCATATAACTGCCAAAAAACTTTGTTATTTTCAAGGTATTTTAGCGAAATAAACCAACTCCAAAC CTAACTAAGCTCGTAATATATGAGTAAGTACTAATCAGATTCAGACAACTGTTTAATACAAATAAGTACA AAGCTATTATTGTATAAACACATGTTTGTCAGGGTATCAAATAGTCGGAGCTCCGAAACTACCAAAAGAC CGTTATAGTGAATTTAAAAATATATTCTTTTCTTTATAAAATTTGTAAGAGAATTACGTTTAACTTAATA GCTTAGACCCTAATCTATAGAAACATAATCAATGTTCATACGTACTTAATTACATACTAAGTTGGCCTTT ACCACAACATTTAATTGAACAATTTTTTTTTTGCAATTGGAAATTGTTCTCTTACTAAGTGCAAGATATG GCTCACGATACAATAGGCTCCTTATCTATCAGATGAATCGACTTCAATTTATATTGCGCTTACGTTTCAG TAATGAAAATAACGTATTTAGTATGTACAAATATTAATCTCTATTACCTTATCTTAAAACAAGCGTGTTT AATCATATAAGAATGAGTATAATAATATAGATGAATTTATATTCCAATACTAAATATTTATGCGTTGTAG CTATGATTACTTTTGTTCAATAAACCAACTTTATGCACATATATAAAAATATACACATGGAATATATATT ATATTCAAATGCATACATGAAATGTATATACATATTTATATGCAAATTAAAATTAACGTTTATTCTGAAA AGCACCAGCATAATTATTTTGTATAGTTAACGCGAAGTAAAAAAGAAAATTGTTGCTTGGAAAACTCAAC AACAACAACATATAAAAATAATGCTTGACTTTGAGTTGATTAGATTAGAGTTGGGAAACCTCTCTAAAAA TTCCTTGTCGTTGAATCTTTCCAAGTATAAGAACTTTGATTGAGAGGATAATTTTCTAGGAACCATCGCC TAAATGTGGCGAGTCATTTTGGCTTATTATTTGGATCTATTTTTGTTAATGCGGGTTGTCTGTGCATTTA CAATTTTCTGATAGCATCACCTAAACGATAGACGTGTTTTATTTGCCCGCCGGGCCATTTATGTCCCTTT TGCGCAGCTACTTAATTTTGTTGTGTTGTGTTGTTAAGTAAGTATTAAAAACAATCTTAAAGAGTAAAAG ATCATGGTGCACAGAGTCAAATGCCTTACTGATGTCAGTGTAAATGACGTTAATTTCATTTAACCAAAGA AGTAAATTCTTTACGAATCAGACAACTCAATTGTAAAAATGCTGCACATTCGAAGTGATTATTTTTATAC CCTGAACCCATTAAAAATGGGTATAAGGGTATATTGTATTTGTGCAAAAACCAAATGTATGTAACAGGCA GAAGGACGCATCTCCGACCCCATAAAGTATATATATTCTTGATCAGCACCAATAGCCGAGTCGATCTAGC CATGTCCGTCTGTCTGTTTATCCGTCTGTATGAACGCAAGGATCTCAGAACCTTTAAGAGCTAGAGACTT TAAATTTTAGATGTAGGTGATCCTAGTGCCCGCGCAGATCGAGTTTGTTTCCGATAATCGATAACTTACT CCGTTTCCAAGCAATCAATAAAAATCGATATCGATTCCAGTTTTATGGGCAATTTTGGTAAATAATAAGA GCTAGAGTCAGCAAACTTGACATATAGCTCCTAAAATAGAATATATATATGCATTTGATGCTGGAAGACG TGGGTTTAGGGTATCCCCTAGTCGGGAGCTCCCGACTAGAACCTCTTACTTATTTCAAATAATTTAGGGG TAGCTAACAGTTTTGCAATGCCCCCGTAATTTTGTATATCAGACTTTCCACCTTACTTCCACCTTACTTC TTTGCAAATCGATGGAAAAACAGAAGATTCAATGGAATTTATAGCTAAAAGGAGAGAGGAGTGTAAAATA ATAGGAAGAGCTACATAACTAGAGGAAGTGATAGTCCAATGGTAAGAACTATTATTATAACAGGCGAAAG TAAGTTGATTGGAAAAAGTCTGCAAAGAGTTTAGCATATTCAGATCATTGCTGTCTTTATCCATTTTGAG AGAAAAAGTAAATGGCGTAACGTGAAAGATAATAATTTTCATAGCATTGAGAATTTAGAAGAAAGATGTT CGACTTGGAATATGGAATATTTAGCCACGTCAATTCTTGAACCAGGCCTATTAAGCTTTTTAAAATATTA AAACTTAATGCTTTGCAGGTAGTCGGGGACTTAATCAGGGTGGCTTTAAAGAAGCAGTTGAAGGAATGGA ATTAGGAATCAAAACATCTAAGAGGGAGTTCAGGGTGTAATAAAAAACCATTAGTAGCAATCTCTTTATA TTTTATTTTATTTTTTTTTTTTATTTTTTATTTTATTTATTTATTAATGGTCGACAAAACGAGTGTCTTC CTCATTATTCAAAAGATTGTACAATATAATTATATGCTAAAAGCCTAGTTGAAGGATACAATTTTCTAAA TAGCATCACCGACCGATGGAGGTGTTTTATTTGCCAGTCCGGCCAGCTGTGCCCCTTTTCACAGCTAATT TTGTCAGTGACGCTATTAGAGCCTACATCTAAGCAGAAGGTTGTAAGTAGGAAAAAAGTGATCTCAAGTG AAATTAAAAATAATCTTAATTTGCTATATTAATAAAGAAAATACAATAAATAGGAAAAAAGAAAGTAAGA AAATTGTTAATAAAGTAAAGCAATGTAAGTTAGATAAAGAGTGTTGTGGATAGGACAAAGAGAAAAGTAA TGGGAAATCACCGACACGGTGGGGGAAAATTTTTTCAGTCCGGCTAGCTATGCCCATGCTCATAGCTGGG AATGGTCAGCGACTTCCCGAAGGTATCCTGAAAGCAACGATTTTATTAGGGGTAGAGACAGTTCAGTAGA GAAAACGTGATGTAAACTATTATAATTTTTACATAGCACGCGAAAAGAATTGTGCATAGCGTAATCAGTT GTGCACGTAGATAGTAATAAGGGGCGATAATTTCTGGTTGGTCTAGCCGGAACAGAGAATTGAAGACGCC CTACCAGAAAAGGAGAATCTATGTCGCCAATAATCAACTTATGTAGAAGGACAACACCGAGAATTGTCCT ACGGTTGATTAACGACGGAAGGTTGAGATGAAGCAGTCTGCTGGAGTAGGACGGCAACCGAAGATTAGGG TCCCAATTTAAACCTCGTAAGGCAAAAAGCAGAAATTGCTTCCGAACAGATTCAATACGATCCTGGCTGT TGTTATACTGTGGAGACCAGATGCAAGAACAGTATTCAAGGATAGGGCGAACAAGAGAGATGTACAGAAG TTTTGTTATAAAAGGATCGTTAAACTCTTTAGACCATCGTTTAATGAATCCAAGTACACCTTTTGCCTCA TTAACAATGGTATCTATATGAAGATTGAAACAGAGTTTAGAATCAAAAATAACGCCTAGATCCTTAACTG TTAGTATACGTTGCAAAGGGATATTGTCGATTGTATAACTGACAAGATAAGGTGTAGTACGATTAAAAGT CATAAACATACACTTTGAACAATTTAGATGCAATTGATTGGCCGAGCACCAAAGTTGCATAGCGTTTAAA TCGTCTTGTAGACGAGAATGATGTAGGGGGTTAGTGTATGATAGAAAAAGTTTGACATCGTCCGCATACA TGAGTGCACGGGCATGTGATATAACAGAGGGAAGATCATTTATAAAAAGTGTAAAGAGTAAAGGTCCAAG ATGACTACCTTGAGGAACACCAGAAGTAACGTGAACCCTTTTAGAGGTAGTCAACCTCAGTATTACTCTT TGGGTCCTACCTTTTAAATAAGAATTAATCCAAAGTAAAAGGGACAGAGGGAAACCTATTCGGTCAAGTT TAAAAAGTAAAATGTCATGGTGCACAGAGTCAAACGCCTTACTGAAGTCAGTGTAAATGACATCAGTTTG CATTTTCGAAAGGAAAGCATCATTTACCAAGGAAGTAAACTCAAGCAGATTGGTCGTAGTTGACCGATTC TTTACGAATCCATGTTGAACAGGGAAAACAACTGAGTTGCAGAAATGCTGCAAATTCGAAGTGATTATTT TTTCAAATAATTTAGGAATAGCAGACAGTTTTGCAATGCCCCTGTAATTTTGTATATCAGACTTCCCACC TTTCTTGTGAAGAGGAATGATATAAGATTCTTTCCAAAGAGATGGAAAGACAGAAGTTTCAAGGGATAGA TTAAAAAGCTTTAGCAATGGATAGAAAAGGGAAGAACTACACTCCTTGAGTAGACAACTAGGAATATTGT CCGGCCCAGGAGAGTAAGAAGATTTTAGAGAGTTTATAGCTAATAGGAGAGGAGTGTGAAATAATGGGGG GAGGTATAGAACTAGCGGAGGAAATAGTATAAGGGTAAGAATTAGTATTAGGACAGACTGAAGAGTAAGT TGATTGGAAAAAATTAGCAAAGAGGTTAGCAGAATCAGTGTCATTGCTATCTTTATCCATCCCAAAAAAA AAAGAAGATGGCAAACTTGAAGATTTACGCTTCAAGTTTACAAAATTATAAAACTGTCTCGGATTTCGGG CGAATTGCCTTTTACAACGAATTAGATAATTCTCATAGCATTGAGAATTAAGAAGAAAGAAGTTCGACTT GGCTATGGAATATTTAGCCAAGTCTGTACACGAACCAGACTTTTTAAACTTTTTAAAATATTTGGATTTT ACATTTTTTAGTTGTGATAATCTGGGAGTAAACCAGGGTGGTTTTGAAAAAGTAGTCGAAGGAATTGACT TGGGAATACACACATCTAACAGGGAGTTTAGGGTGATATACAAAGAATTAATGGCTGTATTCATATCAAC TGAGTCATATAAGAAAGACCAATCGGTTGAATAAATAAGCTGATTCAGCAAAAAATAATTTCCTTTGCGA AAGCAATAGCGGGGCTTATTGGCTGATGAGCACGAAATGAAAGGATTACAATTTAGCATTGCAATCTCTA AAGTTGGGTGATAGACATCCTCAGGAAGAGATAAAGGAGGGGACCTAGACACATTAGAAATAAGGTAGTC GTTAACAAATACAAGGTCAAGTGTTCTATTCATATGATTAGAAATTGAATTGATTTGAAACAACGAAAGA TCAAGCATGCAGTCTAAAAAATCGTGCTGTGCTGAGGGCACTAGATAATTTTCAGCAGTGAATAATGACC AAGAGATGTTCGGCAAATTAAAATCACCCAACACCAATAATAGGTCATTATCCCGCACGTGTGAAGAAAC TTCTTTAATACAAGTAATATGATTCATATAAACTTGAATATCAGAAGAAGGTGGGACATAAGAGCATGAT ACATAGATATTCCGTGTAGGAAAAGACACCTTAACTGAGACAATCTCAGCGTCAGTAGGCGTACTAAAAC AGAATAGTTCAGACTGGAGAGTGGCTTTAACGGCAATTAACACCCCACCACTTCGAGTCGGCCGATTATT TCTAAACAAAATAAAGTTATTCGGTAATATCTCAAAATCAGATATGGTTGAGCTTAACCATGTTTCTGAA AATGCTATTATGTCCGAATCGAAGGAAGTGCTGGCAATAAAAAGATTTTTTAGCTTTGAAGTGAGACCTC TGACATTCTGATAATGAATAAAAATTTGGTCAGAAGATGAAGCTAGTTTTTTGGGGCAGAAATGGTACCC TGTATTGAAGGGACTGGAAGGGTGACAGGCTGGTTACGCTTTTTAGACTTGAACTCATGAACAATCATGT GTGGTGGCCAAAATTTGGGATCACAAATGATTGGGAACATATCATGTGAAACATTTATTTTGAATGATGA TATTTCACGAGGGGTGGAGAAATTAAATTTAGTTATTGACACGCTAGCAGAAGATTTGCTAGCAATATAG GCTGCCAATGACTCAGAAGTGGTGTCCGACGAAAGTCGAGACACAAAAACTTGCCTACGAGGGGCAACTA CCGTTAAAGTAGGCGCTGATGGGGCTGTAGGTAATACAGGAGTTGGAGGAACTAACGAGGCACAATGATT GTTTTTAACAATCTGGGAGCTTGGAGAAGGCGATAAAGACAACATTGGAGATACCTCCAAGTAGCTAGGA GCAACAACTGTTTGTCCTGACTGACTGACTGACTGATTGGTGATCAACGCACAGCCCAAACCGTAACAGC TAAGATAAGACAGGGATTCGGGAAATTCCACCCGCAAGTATGGAAAATCGCGAAAAACGTTTGTATGAAA AATTTTTGTTTACCATCTGTTCGGCCTCAAACTTAATTTAAATGTTTTTTGTTCAAATTATTTTAGGGGT GTTTTACACTTTTCCAAAAATGTATTCCTCCTTGGTCGAAATGGGGGTCAAAGATTTGGTGGGTGACGTT TCGGGCTCAAATTCATTTTTAAGGATCTACATAAGAAATCATTTGAAACGTGTTTCCCATTTGTCGCAGA ATCAAAACATCCTCGGTAGAAATGCGATTCTACGATTTTTTTTGGTGCAGTTTTAAGTTCTGTCCGATTT GCTTTAAACTTATTCTTAAAGCTCTACATAAGAACATAATTAATACGTGTTTCAGCAATTTGGAAAATTC TACCCAACAGCGGGTAATTAGCGAAAAACGTTGGTATGAAATTTTTTTGTTAACCATCGGATCGGCCTCA AAGTTATTTTCAAAGATCATTGCTAAAATTCATTAAAGGGGTGTTTCACACTTTTCGAAAAATCCATTCC TCCTTGGTGGAAATGGGAGTCAACGATTTGGTGGGTGGCCTTTTGCCTTCAAATTCATTTGCATAGATCT ACATAAAAAATCATTTGAGACATGTTTCAGATTTTTTGCAAAATCTAAGCTCGTTCGGTGAAAAGTGCAT TTTAAAGTAATTTTTTGAGATCATCAAACTTATTTTCCAAATTCTATATAAGAATATAATGAAAAAGTGT TTTTAGCGTTTGGGAAATTCCACTCGAAACAGTGGTAAAATAAAATGAAAATGAAAAAATGAAAAACGGA AAACGTTTGTATGAGAGTAGTTTGTTTACTGTCCGCTCAGTTTCAAAATCATTTTTAAAGCTATTCAAGA ACATTGATTTTATTACATAAGTGCCACGAGCAAGGCCAGGCTATATCCGCTAGTATTTATATAAATCGAG TAATGTAAAAAGACCAATTGGTTGCAGGGGTACGTTGATTAAGCAAGGAAAAGTTTCCTTTGCGAAAGCA ACTGCGAGCTCATTGGTTGATGAGCACAAAATGAGAGGATTAAAATTGAACATTGCAACCTCTTAAGTAG GTCGTCAGGAAGAGATAAAGGAGGGGACCGAGACACATTAGCAATAAGGTACAAGATCAAGATCAAACGA TTTGAAATTGAGGGTACTAGATAATTTTAGGCAGTGAATAATGACCAAGAGATGTTCGGTAAATTAAAAT TTCCTAACACTTTAAATAGGTGAAAAATTTCTTTAATACAACTAAAATCTTCATAAAAATTTGAATGTCA CAAGAAGGAGGAACATAGGCGGACGCATAAACACATTTCTGAAAATGTGAAATTTTTGCAAAATGTATGA AATGCAGCCTGTGCGTTTCCCCATAAGAAAAAAAAACATATTTCACGCATCTTTAACAAGGCATATTTTT GAAAAATGTGTAAATTCTCCCCGAATATTTCGTGTTTTTTATGATTATTTATTTATTTATTTATTATTCC TCATTATTCAAAAGATTATATAAAAGATAATAGAATTATATGCTAAAAGCCTAGTTAAATAATACAATTT TCTAAATAGCATCACCGACCGATGGAGGTGTTTTATTTGCCAGTCTGGCCAGCTGTGCCCCTTTTCACAA CTAATTTTATCAGTGACGCTGTTGGAGCCTACATCTAAGCAGAAGCACTAACCAAACAACGTATAGACTG GACATCACATACATACAGCCACTAACCAAACAACATATAGACTGGACATCCCATACGAATAGCGTTGTCA CAAAAAGTATCGGAGGCATCTTGTCCAAAATCGAGAGTAAGGGAGTAAAATATACATATGATGTATTTTT GAACCGCTTACTCTACAGGAAAGTACTTGGCGCACTCTCTTCCATATGATTTGTGCGATAGAACGGCAAC GCTGTTAACTTTTATCTCGCTCGCATTTACTCTCAGCCAACAATGCTCTCTCTTTATGTTTAAGGATCGT TTAAATGTGTGTGTGTGTGTATTTGTCCGACGAGCAAAACTGCGCACAAATTCAATTTTTCTCAAATGCT GAGGCATTTCTACCCTTTCTAAGTATGAAATAGAGAAAGGGTTTGCTACGTCGATGCGAAATGCTGGCAT TTTAGTTTGCTATCGTTGGTAAGGGTACCCAAGCGTTGGCATGTGTGCATTTAAAATATTTTGGACTCGC TATTCACGCATACTTGTATATTTTGTATATGAATAGAAGCATTTATGCGCTTGTGTGCCTGTTGCTTGCC TGTCGCCGATGCAAATATAACAAAATTTTGGGATTTCTTATTTTCGACCTCTACACATAGACACACACAT ACAAATGTTTGCGAATGGACGGATCATGGGCGCAAAGAAAATATCATTGTGGGCACGCTTCTCTTTTTTA TGATTTTGATGAATGAAATTTGTGTAAAAATAAAAATCTTTAAAATATTAGAATATACCAAATATAAAAA AGGAACGATTATATATTTATAGTTTTAATAATTTTGGTGATCAGTCACTTGACCTCCAGATGCAGGGGCT TGCCAAAATTTATGTTAATGTTTCTAAGCCACAACGCCCACAAATTAAAGTACACATGGTTCTTTCTCTT GTCAACATGTTTTTGTTTTTATTAAACCTTATTGGTTTTTTTGTAATTTATTTTTTTCAATACATCAAAT TATTTACTAGGCTTATGGTTGCTTTTTCTTCATATGTAAATCTTTACTTTATTTTGTGTTGCTCCGTTTT GATTTATAGATAATGTAACTACTTGTTTAGGTTAAGTGTGTGTGTATATAACATTTAATATGTACGTATA TAAGTATGTATAAATACTTTAAAATCTAGATATGTGTATATTATTAATATTAACCTCTACTATTTATGCC TACTTACAGTAAAAGAGCTACTAAAAACAAACGGAACAATTAACCAATCTGTGATATTAATATTGACTTA GCTTACTTTGAATGCAAATCATTTATTCGTACTTATTTCATACTTCTCTTTCGTGCATTTTAAAAATACA AATGTACATACAAACAAATCAAGGCAGCCAACTAACAAGTATCTCATCCAGCAATGCATAATATAAATTG AAATGAATTTGTTCTTTTATATTTATAATTTCAGTGAGTTATTCATACATAAATATGTATGTATGTGTAC TTCTTAATGTGTTTTCATTTTCACAATTTTCAACAGAGATGCACATTGTCCTGATATTATTATATTATAA TTAAATGTTGTCTATAAGAGAAATTATTGATATACATATTGAATGCCATTCACTAATCTGTATTTGAGTA CTGAGTGGCTCGAAAGCTAATAGGGAAAGAATATAGAATATAGCGAACTCACTATTTGTCGACAGATAAC AAGCGTCAATAGGTAATCCACGAAGCACATATGCATTTTAGCTTCAAATCAGAATTGCACAGTAGAATAT CTATTTCTGATGTGTGAAGTTACATAGGAATATGTACATGTATTGTACATACATGCAGCTTTTGAAAATT TTGCACTTATATGTAAACGAAGAAACTGTCCTACAGAGAAGCGAATGTACAAAGGTATGTGAGTGTGCAT GTGGGGGCCATTCCGACATACATACATGGTATCGCTTAGCAGGCTTTGATTTGATAGTCTCACAACATAT TTGTTTAAAGTGTCTGTTCTCCAGAGATACACAGTATATACGCCTATGCACATTCAGGTTAGTGGGTTGT ATGTATGTACATCGTTGCACATTGAAAAGTAAAGGCATTTGTGGATTTGAGCGTGGACTTATAATAATAT TATATTGTATAAAAATTGTGTTGAATGTAAATTAGCATTTAAATAATAACTTAATTATGCGGAAACGCCA AATAAGAAATGCGCGCACATGTTGAAGTGCAAATTAATGTTAACATAAAGAATATAAGTCAATAAATAAA ACTGTAAATATTGCAAAACGGTTTCATATGCACTATTTACTAGGTAAACATTTAAATAAAAACACAGAAA ACTGGAAGCATAGTTAACGTAAATTAAATATAATATTGATTTTTGTTTTTAGAATTTTTTGTTGATTAGA ATAATTACTAAAGCTAGCGTTCACTTTGCAAATATATATATAAATACAGACATTTATAGATAGGTGTGTA CATAAGTAGAACTATACCTCAAACCATTTTTCAATGTCTGCGTGATTGCGATCCTTTCGACTGCATACAC GTTTTATTACCTTTGACCTGTGTCATCATAATGTTTGCCAGTTAATAATTACATTTACACATGTTTACAT AAATATGTTAGGTTCCTTTTGCGTGTCTGCCTATGTACATAGTGTTGTATGTCTGTAAGTAATTCGTGCC AAGTACATACATACATATATACTCGTATTGACTTAAAACACGTGTGCTTACATATGCACATACACATAAG TGCATATATATGTATGCGTGCGCACGTATGTATTCTATGTACATATGTTATTAATTTAAATATGTATTAA CAGTCTTTTTATAATTGGCAATGGCTTACACATTGTTGTGCTTACACTTACATATACATATATATATATA TATACATATATGTACATACACATTTCCTTAATATCGCATTATTTAATTCACATTATTATTTATACTTCTG TACTAAATGTTTGGCTTGATCGTCCTCCACACTATATATTTAAATCAACACTGTTTGTACACGTGCATGT TGAATATATATATTTACATATTGATTTAACTGTGTATGAAGGTTTATGCTCATATTTCGTACATATCATT TATATAAAGCAATATTCAAGTTGAACCTGATATTGATAACTATTAATTTAATGTCTGAATATTGTTATCA TACCGATTCTTAAGCACCCAAATATCTATCTGAACACGCTCATACATATAGGCGAATTACATATATAAGA CAAATATGAAATCTCTGCTACATAATGCAGTTTAATGATGATTACCCTATAAATCAAATAAAAAATATCT TTCAAATTCTATTGAAATGGGCTTACAAGTTTCTTGACCTTCGGGTGTACCCCGATCAACTTAAGTGTTC TCGCATATTTTAGAGATAATCTGTGTTGAATACTTTTGACTTTCTTGGCGGGAACAAATTGGTACAAATT CGAGGTACATTTTTTTTGTTAGCAAGTGTCAGTTACTCATGTCTTCATTTATTCTTGGCTATTTTAATAA TCATATTAAATGCTGTTTTAATATTTTTGAATTACCAAACCAGAACTTGTTTTGTTAAAGAATCGAAAAT TAATATTTCTGCCCATTTAATTTTATAAATATAGTAGACATGCAGTATAGTATGCAGTATATAGTCATAT ATGTAAGTAAGAAGATTACTATACACTATGCATATATATACATATACATACATACAGTATAGCTATCAGG TCCAATTTTTAATAAATTCGTACGTTTTGTCTTAAGTTTCTTCTTTGTACACACATACACACTGCCAGAT ATACATACATGAATAGATTATATTCTTTAACAATCATAAAATAATACTGTGTTTTATGCGAATTTTGTAT TGAAAACAAACTCTGATACTCCTCATGATTGATTTGTATAAATCAACCCTATGTTCTTATCATTTTCTTT TCTCTATTTTATATTTTATATTTGTTCTCTAGCATTGTGAATATCCATGATGCATAAGGATTGACTACGT AGTTATTCATAAAAATCAAAATGTCCGTTATTTTAAATTATTGGAAATTAAACTATTTTTATACCCTGAA CCCATTAAAAATGTGTATAAGGGTATATTGTATTTGTGCAAAATCTAAATGTATGTAACAGGCAGAATTA AGTATCTCCGACCCCATAAAGTATATATATTCTTGATCAGCACCAATAGCCAATTCGATCTAGACATGTC CGTCTGTCTGTCTGTCCGTCCGTCCGTATGCATGAACGCAGGGATCTCATAACCTATTAGAGCTAGAGAC TTGAAATTTAGATGTAGGTGCTCCTAGTGCCCGCGCAGATCAAGTTTGTTTCCGATAATCGATAACTTAC TCCGTTTCCAAGCAATCGATACAAATCGATATCGATATTCTGTTTTTTGGGCAATTTTGGTACATAATAA GAGCTGGAGTCACCACACTTGACATATAGCTTCTAAAATAGAATATATATATGCATTTGATGTTGGAAGA AGATTGTTCAGGGTATCCCCTAGTCAGGAGCTCCCGACTAGAACCTCTTACTTGTTTTTTAGTTGGTTGT TTTTCTATTGGTAAAATGGTATGCAAATGTAAGTTCTTTTAAAACTATTTTCCAAATACTACGTATTTTA TACTTCTGCCTTTTGAATTATTTAAATAAAAGTATGATTTGCATAACATTAAGCTGCGTTATAATGGCTT TTTCTTTGACCACCCCTCTAATGAATTTGAACAAAGATCTTTGAAAATGGGCTTGAGTCCGTTCGAAGGG CAAACGAAAAAGTTGGAATTTACCGAAACGTACATTCCATTACGTAAGTTAAGTCTAGCTCTCAAGATCT TAGTGTCGGGGAAAACACTTTTTTCTATAGAGATAACATAAATTTCAATTGGGTGCTGGATAACTCCCCG CGTCGGAAAATCAGCCGCAGTACTCTTACTTGCGCTGAAACCTAAAAGTTTAGTTTTGCAATTGGCCTGT AATTTCTAATGGATTATCCGAAATATATTTATGCTTGTATGTATGTGTGTATTATGTATGTATGCACATT TACACTCAATGTATATGTATATTTTGATAGCTACGAAAGCTCAACTAAACTTTGTGGGGTTGTCTTGACA TGACATTTCACCATCACCAGATCTCGTGGCACACTCGAACTAAGAACTTGTATACGTTAAATTCAAATGC TTTTCGATAATTGTTTGTTGATAAGTATGTTATATATGTATGTATATATGAAGTAAGGACTTTTGGCACT AATCCAATAATGGCCACATGTTTCTTGTTACAACTATGGCGATGGTGATGAGCGCTAAATGGCGATCGAG ATGGTTCTTATTGCACGTTGGGCCAACTTTAGCTTTAGCTTTATTAGGTAGTTGGCTGCTCCATATCTTA ATGACTAAGGCATGGACATCAGGGCGGGACGAGGCTCTATTAATTGTTACTTTATTCACATATACTGGAT TGCCAGACTGCTACGAAACACTAATGGCTCCAGTTTCGGTTGCGTTGGGAGTTGCGCTATTTCCGGTCGC TGCTGGGGAATCGGATGTATTGCGGCGTTTCATACTATTCAGGGCGGGCGTGTCAATCGGTTGCACGACT GACCCGATGCTGCTGCCGCTGCTGCTTGTGGCTGACAAATGGTTGTTCAACTGTTGCTGGAAGTGTTGAC TAAAGCTGCTGCTGAAGAGCGCATGATGCGGATGAGGATGCGGATGCGGGTGAGTGTGCGTGTATGGATT ATGGGCCGCGTTATGGCGCAAAATAACTGAAGCTGATTGCGGGTCGCAGCTGCCGAGTATCACAATGTTA TTATCCTCTCGCCGCTTGGTCAACTGATTGATACTCAACGGATTGTTAATGTCACGTGGGTTAGCGCCAA TCGGGTTGCGATGTAAGCTTGTTGCTGGTCCAGTAGCCGGCGCCGGCGCTGATACAGATGCTGCAGCATT TGGTACTATTGTCTTTATGCTGCCACCCGCTGTTACAGAGCCCGTATAACTGTTGAAGCCATTTGTTGCC AAAGATGTTGGAGTGCTGCTGCTGCTGCTGCCGCTGCCACTGCTTCCAGCGAGGCTTACAGCAGCCAGGT GGGTGTGCGATTGGAATAGTTGCTCTGGATTACTGCCACATACGGGTAGAGTAAGCCCCATGCCTAGATG GCTAAAGCGGGTGCCAAGCATCATGGCGCGCTCACTGACAGAGGTCGGCGCTGTTCCGGTCGCAGACGTC ACTGGCGACGCTGTGCTAGAGGTATTAGGTGTGTTACTAATGCTACATGTTGATCCGCTGCTGGACCCAG TCCCAGACCCAGGCGCTGATCGTGATTGACTGCTCGACGCTGCCTGCTCATTGCTGTTGTTAACAGGGAG AGGGCCTATATTGCTGGTTGCAGAAGGTAGAGCGGGCGTTGCTGGACTAGTTAGCATGTTCATATTTAGT GGACTGGCCAGGCTCGTCGTTGTCGAGGGACTTTGCACACTGGACAGTCCGCTCAGGCACCCGGGGCTCG ACAGCGACTGGCTCATTGACTCTGTGTCGTCGTTGTCGGCCATTTTATTTGTCTCGGTCTCATCCCCGCT GCCACAGCTGGCACCACCCAATTCCTCGTCATCGTCGTCATCATCACTCAACTGGCTCATATTGCCAGCA TCATCCATGCCGCTACCGTTCGCCAGCGCGCCGTTTCCATGTAATGCCTCCATGTAGCGAATGCATTTCT TTTTGCGTCTGCGGGATTAAAAGAGACGTATATAATATACATTATTAGTTACATAAAAATGGGAATTGAA GCATTGGTAAATGTGGTATTGGCAAATATGAAGGCATTCCACAACATATGCAGAAAAGACCATTTACTTA ATAAGTGCATGCACACGGTGCGACCGGGCCTTAAGTATCATTGAATAAGCTAATGATCGTGCAAAAACAT ATTTGAACTGAAGATATTACATATTAAACGAATCAAGTGCATAGAACTTCAAATTAAGAGAGCGGGCCAC TGTTAATTAAGCAGGACTGAGAGTAGATTTGAAGGTCAAAACGGCGCCAATATCTCTATTTTCTTTTCAA CCTGGCGATTGGCATTCAAATGTCAATTTTATCATATATCGTTTTTATTGATGAATTTATTATATTTAAC AAATTTAACTATTTTTTGATTCGGTTATAAAAAACCTACACAATCATAATTATAATAATGATAGTAATAA TAAGCTTTTGTTAGTTTATTTATTTGTTTATTGATAAATAATTAAAATTTACCAATTAATTCTGTACTAA TTATTTGATTTAACTCAAATTGTTCTTGATTTTTTGTAAATATAATATAAAGGGGAATAACATTACAATA AATCAAAATCTTTTAATTTTTCAGATAGGTCAAACCAAAAAAATAAACGTTCCAGAACTCTCCACAATAC CTCAAGCTATACAACATAAATTTTGAATTATAAAATAGTCATATGTTGGCTGTAACTGACCATTTATACT TAACTCCTCAAATTGATGATACATTAATAATGGATTATTGCTGCATGCACGAATCATAACAAAATCAGAA ACTTCGAATTATTTAAACATAAATATTAAACAGAATATATATATATATCACGAGGGGTTCTAGTCGGGAG CTCCCGACTAGGGGATACCCTGAACCCTCTTCATCCAACATGAAATGCATATATATATATTCAATTTTAG AAGCTATATGTCAAGTTTGGTGACTCGAGCTCTTATTATTTACCAGAATTGCCCATAAAACTGGATATCG ATATCGATTTTTATTGATTGCTTGGAAACGGAATAAGTTATCAATTATCGGAAATAAATTCGATCTGCGG CACTAGGAGCACCCACATCTAAAATTTCAAGTCTCTAGCTCTTATAGATTCTGAGATCCTTGCGTTCATA CATACGGACAGACGGACAGACAGACAGACGGACATGGCTAGATCGTGCTGATTGGTGCTGATCAAGAATA TATATACTTTATGGGGTTTGAGATGCTTCCTTATGCCTGTTACAAACATTTGGTTTTTGCACAAATACAA TATACCCTTATACCCATTTTTAATGGGTTCAAGGTATAAAGGTATAAAAAGGTATCTAGTATATAATACT TATATAATATAATATATCATGATATACATTATTATATATGTATATAATATTTAGTACACAATATATAAAA AGCACACCAAAAAAAATTTTTTAAAGTATGGAAGTTAATAGATTCAAATAAATTTAGAGGTCATTCTATT TATTATTTGGGTACTTATAAATACTAATTGCCAGGCGATTGACTTTTTCAATTTAACAAAACTAATTGAA ATCCGAAATCAATCTGCCTTACGATTTTGATTACGCTTGTAATTTACAAAATCGATATGGGCAATGGTAA AGTTATACTGATAATCTGACGCATATTTGAATGACCGTAAAAATAAGTAAATAAACTATATTTCAAGACG TATGGTATAAGCATATAAATTAAAGCATCAGCATTTCCGATAATGCACGTTCCAGTAAGGCATGCATAGT AATAATTTATCTGCAGACATTTCGTAATGTACTAACAAAAAACAAATAATAGGTTTAAACGGGTAACTGA AATGGTAGAATTAGCAATCAATACACTTAAACGTGTTCATCGCAGTCAATAATACGTAATAAATCATCAG TTACATTAAATAATGGTTAAAGGGCATAAACGATTGTGGTTCAATAAACATAACAATGATACAACATTTA AAAGAAAAGCCAGTGTCGCCGTTAAAAGGACCATGTTCACAAAGTCAAATAAAAAAGACAACAAACTTCA AAAACAACAACAACAACAGCAACAACAGCAACGACAACAATAACAAACAGCTCTAGCAAAAATTTTAAAT TGAGCTCGGTTTAAGTACAACACATTTAAATTATCAAAGATACATTGCATATATACATATACATATACAT ATACATATACATGTACATATAAGCGCATGTATATGTACATGCACATCAAATAATATTCCCTACAATCAAT ATCCAAATTTTATCAAAGGCCACAAGTGCCGAAAATTATATTCGTATATGATCAAAATCAATATATTTAC ATTTAATTTTATTATTAAGCGCTTACACAGGTAAGCAATGTTCATACACAGAATTAACTCAGTTTCATTT ATATACATATGAAATATTTTTATATTTAATATGATTTCCTAGTCCTTAGCACCATTGCATGCCGCATTAG CACAGTTACAGTTGACTTAACAAGTCGCATTATTCTTTCCAATTTGTTGTGCACAATATTATTAACCTAC TTTAAAAATAAAAATTGACTAGATCAACAACTCTTTACTCAACGTCCAATGGAAAGGAAATGGAAACGAT ACAATAAGATAAGAGAAAAAAAAAATAAAATAATAGAAGAATATCCATTTGATGCTCATTTAAGGCAAAT TTCATATTTTTAAAATGCAATTGTTATAATTCATTTATGTACTAATAATAACACTAAGAGTCTTTGGCGA AAGATGGAATATATAAAAGTTATTTATAAATTTGAAAACTATCTGACTGAATCAACTGATTCAACGTGAT CCAACACGATTCGCTTGGACAAACAATTGTTCTCTCACATATTTATTATTAATATATGTTTGTGATATAA AGGACCATTTGATTTGATTCTTCTCTCGAATCATTGCACGTGTTATCAAAATTATAAAACAAAATAAAAA TCCGCTTGGAAAGTAAATTAACATTTGTTAGTATTTTTATATCTTGACGATTTTTGCTCGGATTTAGAAA GCTGTTTTCGGGCTCTAAGTGTATTTTTTGGGTACTTTAAAAAAATGTAATAATAAAAATGTCGTTTGTT ATTACAAATTATTGCTAATGCGGCTTAATGCTAGCTTTTTGCAAAGACTATAATTATTTGAATATGTTGT TTGGTTAATTGTAATGCAAATTAGAATTCACAGAATTATTTACAATAATGTATATGTAAATGTACGTTAT TTACTGGCATTTATGCTGAGTCGTACGCCTGCCTCTTGTTTGGGCTGCAATGGAGTTTAGGATGCAGGTT GTTGTCCGGGAGGCTGCCTGCTTATTTTCGCCGCGGTCTGCCATCGTTTTTACAAATTTACATAGGTCGG GGGTGCTTGCGGTGACAGTTGCTGTGTGCTCGCGGCACCGCCAGTCGCACCGCCTCCAACACCACCCCCT CCACCACCGCCGCCGCCACCACCAGGTTGTGTACAGGCGCCACCATTGAGAGGTGCTGCCGATCCGTTTC CGGTATTGCTGGGCATCATTTGCAAGTGTGTGTGCGTGTGCGAAGACGATGTAGATGACGATGAGGAACT TGATGACGAGTTTGGCAGCATGACAGTAGCCCCCACCATGCCAGGCGTCAGCATGCCGACACTTATGCTA TTGACACCCGGGCCACTGACAATTCCGCCAACGGTACTGTTGCTAGCCGAAGAAATGACGCCCAAACCCA CACTGGGACTGAATTAGAAATTCCAAAATGTTATTTGGTTAAGCAATAAGAAAATAACGGTAATTATATT CGTCAACATTTCGTTTACTCATAAAAAAAGGCATATTGTTTGTATGTGTGCTTGTTTGTACGTGTGTGTA TTTTGAATTTGTTTATTAAGGATCATTTAGTTCTAATGCCAGAACCATAATTGAACGATCACCTAACACG CAAAGCTCTATTATATATTATTTTAAGTCCTATAACGATATTCGGCTTTCTTTTTATAAAAATAATAGCT CGCAAGAATTTAAGATGAGACGCATAAAAACTAGAAAATCCAGAGTAAAATAAGAAAGTAGTGAAAAACA AGTATAATATAATTCTGGTGGTAAGCCGATATTTTTTTTACTATTTTGTGACCTTTCTAATGAAATGGAA AAAAATAGATAAAGCATTAATTATGTCCTTTAGACACAGTTAAAAATAAAATAGCTTGGGAAATAATCAA TTTATATTACAAAAAAATTAAAAACAATCATGAAAGTAAGGATTCGAAACCTTTGTTGAAGGTAGTAAGT GCTGAGTTTTAATGAGAATATATTGAACCGATGTTTCATATGGTAGCTATATGATATAGCAGTCCGATTT TGACAATATTTTGGGTATATACGAAAGGAGCATACCAGGTGAAACTTTTCGGCCGGTTCCGACACATGTA CTGCCCGCAACAGTAAGATAGAATGAGAGACTAGTTCACATAGATCCAGACCTCGGCTGTTAATGTGATC TAGCGTATATATACTTAATGAGGGGCGGAAATGCGTCCTTCGATCTATGATAAAATTGTATTACCATCAA CAAAGATAGTAAATACTCAACAAAAGGTTCTAGTCGGGAGCTCCCGACTAGGTGCTACCCTCTACCCTCT TCTTCCAACATCAAATGCATATATATATATTATTTAAGAAGCTATATGTCAAGTTTGGTGACTCCAGCTC TTATTATTTACCAAAATTGCCAAAAACAGGATATCGATATCGATTTTTATCGATTGCTTGGAAACGAAGT AAGTTATCGATTATCGGAAACAAACTCAATCTGCGCGGGAACTAGGAGCATCTACATCTAAAATTTCTTC TAGCTCTTATAAGTTCTAAAATCCTTGCGTTCATACGTACGGACGGACGGACGGACAGACAGACGGACAT GGCTAGATCGACTCGACTATTGGTGCTGATCAAGAATATATATACTTTATGGGGTCGGAGATGCTTCCTT CTACCTGTTACATACATTTTGATTTTGCACAAATTCAATATACCCTTATACCCATTTTTAATGGGTTCAG GGTATAAAAATCGATTGCCAGTTTAATAAATTTCTCATTAATAAACGTATATTGGGACATAAAAAAGAAA ATAGAAAATTTTGTACGATTTTTAAAAACACTATTTTTGGAATATATATATATATATATATATATATATA TATATATAAATAATATATATATATAAATAATTTAAAGCGATTGGTCAGATTGGAAGTTTATCTTCAAAGT TTCTGATTCTGCAATAGTATTTCTTCAAAGTTAAGTTTACTTTAGATGGCAAAACTTTAGGTTTCAAAAT AAACGATGTATTTTTAAACCCTACATTTGCTTTTAGCTTTAGGTTTATGTGTTACTGCTCACTGTTGTCA TATACTAGGAAATAATAAAAAAATATCAATTTTCGTAACTGTTTCTACTCTTCAAAGTAAAGATGGAATC TGGAGGGGATCGCGACAAAAAATTGCGGGGTGGGCGCTAGAGGTGGGCAAGATTTTTGCATGCTCAAAAT CTTTATGGATCGGCATGGTTTTGTAATAAGGTCTCTATAAGAGGGTCCTTATATATAAATAATCTTTTAG ATATAATCTTGCCATTTGGAAAATATATGATAAGAGCATTGAAGTACGTAGTTGCCGAGTTTGGTGAAAA TATTTTGAAAAACATAATATTTTGCTTCACCCAAAATAAATTGTTGGCCGTTTCTTCCTATTCAGCTGTA TGTTATAGTATTGCCATTTTTCTAAGCACTCGGGTCGGGTCAAGAGAAGTTTTCTTACAAGAACCTTATT TTCCACTAATCGTTTCTACAGCAGCTACATACAGCGGTCCGATCCGACAGATATACGGAAACTAAGAGAC TAGCTTGCATAGGAACAGAGAGGCGGGCAGATGGATATCGACTCCGTAATTGATATCAATAATATATATA TGTATATATCTTATAGAGTCGGGAGTGTCTTCTAATTAAATCGCCGTCTTCAAGGGTATAAAAACCACGA GCGAACGTAAAAGTTGAACTGATCTAAACACAAAGAGGTCCAGTCGAGCAGATACCATTTATCCTTTATC CATTATCCTTTTATAGAAAACATACACAAAAACATACTCTCATTCTCGGGAAAACTTGTTGTTCTTAGGA ATAAAAGTATAAATGTGGTAAAAACCAAATCCATATTTAGGGTATACGCCCAGAACAAATGTATATAACA AGCAGATAGAACGAAGTATCTCCAAATGGTTTACATATTCTTAGTCAGCATCAAAAATATGAGCTAGAGG CTAGAAAATTTAAACAAAGGTTCTCTTACTGTGGAATTTGGTGATACTATATCTTAGCACCTAACAGAAC AGGATTTTGATATTAATTTTTGTAAATGGGACAATTTATCGATTAGCGGAAACAAACTTGTACAGCGCGG GTACTAGGAGGACCCACGTTTAATTCAATTGCAAGTCTCTAGCTCTTATAGGTTCTGAGATCCTTGCAGA CAGTCGGATATGGCTAGATCGACTCGGTTGTTAATGCTGATCAAGAATGTATGTACTTTACGGGGACGAA AATGCTTTCTTCTGCCTGTTACACATATTTGCACAAAACCATAATATACTTTTCACCCATTTTCAATACA TTCGACCCAAAGTTAGTGTTGGTGAACGAAGGTTCAGAGTATCCCCAAGTCGGGCTCTTCCAAGTAAAGA GACTTGCGATATTTCCCAGACTGACTGAATCGAAGTTTTTTGCTACAAATTTTTCAACCAAACAAAATCT CGTTCATTCAACGATTGACCCGTAGTTTTAATGCGTGAAAAAACTATTTTTAAATGAGTTTGATGTCGAT TGAATGGTAAAGGGAATATTTTCATGTCCGGATATTAGCTTTTTCCCATACTTCCAGGTGAACTTTGCGA AATATCGCATTAGCGTGCCCCTCCATCCCATACGGGAACTGCAGTACAAATTTCAGCTTGATTCCCAATC AGTCAGTTAGTCAGTCAGGGCAAACAATTTTTTATGCATAGACTACCGAGTATTACCAGATCTTGTCCGT GCACATTTTATGCTTATAATTTTAGATATAAGCTTTTTTTCCAGATTAACCACTCGGAAAATTAAAAACT TCACTTACTATCTTGAGCCCCAGGCATCGATAAAAAAAAATGTTAGCGGATATCAAAAATGATCAATAAG TTGGAGTCAACCTTTTCTGCGGTTAATAGTCGGTCAATTAATTCTCACAAAAATGTATGAAAATGATTCT AAACCGACCCGATTGTGAACAAAAACAGTTTGTCACGATTTTTCTTGAAAAAGCATTTAATTATGACTAT GATTTTGAATATTTTGTTTGTTCATTTCCAACGCTCTTTACAAATATATTTGAGACGTGTTAAACACTTT TTGTAAAAACCAATATAATTTGGGGGAAAATGCGATATAAAGAACTTATTGTATGCGTCTTTTAGCAATA TTAGAAATTCCACCCGCAACTGTGGTAAACTATTGATAAACGGTTATTTGATCGCTTCAGAGATTCAAAA TAATTTTCAAAAATCTTTTAGGAAGTTAATCTTATAACACTTTTGCCAAATCCACCCTTCTTGATAAACG CGGAACAAAGATTGCATGACCGTAGTTTCAATCTCTGTCCGATCGGCTTAAAACTTATTTTCCAAGCCCT ACGAAAATTAAATGCGTATGAGTTTCAGCAATTTTCGAAGCTCCCACTCGCAACTGTGGAAATGTGGCAG AGAAATTTAGATATTTTTTGTTTATTATCAGTTTTAAACATAATTGTGAGAAATGGTTTGATACATGCTT AGCAACATTCGAAAGCCTACTTTTCGGCTTCAAGCTTCTATCCACAAGACTTACGTGAGTGGACACTGTT AATTCCTACTTTTCGTTTGTTATTCGATGGTCATTAAATATGTTTTCAAATAGACGTAGAGTTCAAGAGA GGTTTAAATTTTAGGGAAAATAAATAAAAATAAAATAAAACGAAATGCACCCAAGTGCACAAAGCAATGA ACTAATATTTTTTTTAAATATATTTTTGTTAATACTCGTATATTCCTTTACCCATTATATATGTAGGTAA AAAGGTGTTAAGCGTGACCATCTAATTTACAAAGGAAAGCTAATCCCTAGTTTTGATTTTTCCTAAGCAA GTGCTGTTTCCTCAAACAACCAAATCAATTTTTTTAATTGATGCATATACTTATATTCAATGGGAAAATA CAACATATAAGGTTTCGAAAATCGACAAAAGCTTATTCAAAAGTCATTGCAATTTGGGTAAGCATTGATA AGTGACTAGAGCTTCGAATGAAGAACAGAGTTTGTTTTCAAATTATTTAAGTAGATTTGTTATCGCTGAG AGATATCCACTTTCAATAGATCAACATTCAAATTTGTAAATAATAAATTTGTTGGTCCTGTGCAGGGTGC AGGCAAGAAGGGGGCATTGTAGGTAGGAAACAGCATTAAGTTGCATGCAAATACATTAAATAGTATCGGC CATATATTTAGATTGTGGCCACAATGCCCTTTGTTACTTAATAGTCATTACTGTTAATTATTATCTAGAG CAGGTATCGAATAATATGTGTATTTAGGTGTGAGGTGAGTGTAGAATAATGTGTGATAGATAGATAGTAC TTATGTTGATTCATGTGTACATAATTAAATTGATGAGACAATATTTGTTATACCTTCGTCTACTGTACAT AAACAAACATATGTACATTTATATTAGAGTTGTATTACATTGCCACTGCGAACTATTTCCTTGAACGTTA GCTGTTAGATTATATTGCTGAATGCAATTTTTTGTCAGTACTATCAGTCTTAGGCTAATATATTAAGTAC AAATTATAATAATAATAGATAAGTTCGTTCATACCATTTGAGCAATCGAATTGGGACAAGAGAATTATTG CAAAATGGACAATGAACGAACGAATGTTTGAACTGGACTAATTATCTGCATACACACGACAGTACGCTGT ATACTTTGATTCTGTATGTCACATACTTATTTAAATTTAAATAGCTATTATATAAGATATTTAAAAAAAA ATGGGCATCAATCAGTTATTCGATTTGAATGCTGGCCATCAAATTTGGACTTCACTTTTTCCTTAATTAT AAGCTTATTACAACTCTAATATGCGTGTACGTATGCATGTCTTCCATGTTTTAGCCACTTATGTACAATC ATGCTACTGCGCTTATGTTTAAGTACTTTATTTGGAGCCATTTAGTGAAACAAACTCAGAGAGAGGCGTG CTTAAACGCCAAATAATGAATTGATGAAGCGTAGCCTAGATTATTTTAGGTTTTTTCTTTTTTCTTTTTA TACAAGTCTGGGAACTTATTTTGTAAGTTTGGACACGCTGTGACAATTTGAAATTCGCAATGTGAATAAC TGATGGATTTCTTATCATAAACGCAGTATGTTATATCTTGAACAAGCTGTCAACTTAAAAGATACATTCA ATATATAACCTACCTGCAGGGCTTGCACCATTGATTCTGCTGGTCCAGTCCAAATCGCGCTCGACACTTT TTCATGTTGTTACCTACGGAAAAGAATTTAAGATTGGTTTTGGAGTTGTTGCAATTTAAAGGCACCATAA TTTAACATGATCGAGTTGTTAGTTGAGCAACAGAAAGGTAGTTTAAGCATTCATTACAATTATGGACTAA ATAAGAACATATAGACACTACAATGACAGCATGATACGAACAAACAATAAATTAATAATGTATAGTTAAC CCTTAAACTAGATATAGATTTACAACTTGGCAGTTCCATTTATTTACATTTCATGTAACTTCCGCTGCGA AATGGGCTGATTCTATATAACGACGTTTAAATAATTTTAACCAACGAACATGAACGTCTAAGTTAAAACG AGCTTTGAAAAATGATCGAAGTTCGAAAACGCGAGCCTAACCAAAATATAAATTAAACTTGCGTTTCAGT TTTTCTAAAATTATTTGAATTACTTTAAAGCTAACCTAACCAAAATATAAATTAAACTTGCGTTTCAGTT TTTCTAAAATTATTTGAATTACTTTAAAAATTTATGTAAGCAAGCTACCGAAGAAAACTTGTTCCATTAT TTCACACAGTACATGTGAATACATACATATATATATATTTATGCATTTGTCCTTTCTAATATCTTTGGAA TTAAATGTCACCTAGAAGGGGCGCAAATGATGTTTTGAATGCGATCTGCTCATGATGTTAATTTGTTGTC ACGATAATACTGAAATGTGAATGTTAATAAGGAAATAACCGACCCATACGCCATTCGCCAAATAATGGCA AGGTTTTACCATTAGCATCTGGCTAATATAACTCACATTGGCTAACACATAAATAATAGTTGATTGCTTT AATTGTGTTTGGACAGCATAACTGATTCAGTATGATTTTACACACAATATTCATATACAAATAGTTTCAA TTGCGCATGCACTAATAACTAGATGTATGCGAGTACATATGTAGTATAAGTAAACTGTGTACCTATCTAT ATACTTATACTACATTATAGTGCGTATAAGTAAGCAGTATAAGTACAGTTCAGTCTCGCATAACATAAGT AACAAGTTTACTTATACGTATTCTAAGCCATTTTACTTATAATTACTTCAACTTTTACTGCATACTGTAT ACACACATGTAAATTACTTTCTACATATGCGACTGTGTAGTATAAGTGCCTCCAATTTATACGTATAATG GTATATGGGAGTATGCAGTATAAGTACTTATACTGAGTGAGTACTTATAATTATACTGTATGCTGATACT GCATACACACATAAGACTCATTTCAATAGAAAATTATATCATGCAAGCAATTGGATTATAAGACTAGGTA ATTGTAATTTTTAATCATAATCACTTATTGACAATCAGACATACATAAATATATAGATACATACATACGA TAATGATTGATGAATGAATGTTTGGTTAAATTAATTATTACAAAAAAGTTTCGGTAATGCCGAGAGAGAA AACTGCCTATAAGCAATTTGGAGTTAAGCAAGTAGGATGCAAATTATTTACAGGGCAAATTATTTACTAG GGTGAGTTTTCTACGGATTTCCTAAATCTACTTATTGTCATAAATAAGTTGAGGAAATTTTGCGTTTATT AAACAATCATTTTGATCCATGTTTTCATTATTTTTAAACTTCGTTCCAATCGCAACAACAAGTATTTTTT TTTTTTTGGTACTTACACAAATGTGTGTTTTCGTTTATTAAACAAACAAATTTATTATATTAAGATGTAA TTGTCTGATTAAATCGTTTGATAATCATTTAACGTATGTCTGGCTGTTTAATTTTGGCTTAGATATTGGT TTGGTATTGGTATGACATAGTACATATGTATCGTACAAAAGTTTAAGAAAATGTATCTAACCTCCTCCGT CGCTGCTCGCATCTTGCTTCCGTTTCCGCTTCTTGCCGCGTGACGCGTTCGTGCGTGAGCTCCAATCGGG ATACATCTGCATGTGCAGCTGGCGTTCCCGTCGTGCCAACTCGTAATATTTGGCCTGCTCCTCACGCCCC AAGGCATGCCACTGGGAGTGGGATATATGCGAGGTGTCGCGAAAAAAACAGTGTGTAATAATTGTTGTGT GCAATCGTTGCGAATTTAGACATATTTCAAAAAATCGAATACCCGGATTTTCGTATTTTCGATTTTCGTA TTTTGTTTGGTTCGAGGCGATCAATCGAATTGTTTTTTTTTTTTTTTTTTTGTATTGGTTTTGTTAGATT TGGTTGCGATATGCGCAAATCAAAATTATGAAAAATAAAGAGAGATAATATGCAATTATACATTAGTCAG TCAGGTGGTTTTTTTAAACGCTAATTATCAGCTATCGGGCACCCGCCAATCTAAACACAGTGGACAAAAG CCGACACCAGCCTGTTTTGTTGGTGTCGGCGAGAATCTTAGTATATGCAGCGGGCGCAAATTGTTCAAAA GCTTTGACGGATCGATCTTGTATACGGTTTCGGGTGCATGCATTCGCCAATTTCAATTTCAAGTCCTCAC ATACAGATTATTCGGGTTGTTTATATATGATTCTTGTGTTCAAGAATCTATGGAAATGAAAGCATTAAAT AAAATGAAATGTTTTTTTTTTGTTTCTACAAATTTTCCTGTTCTCTGCACTCTGATTGCCAATTCAATAC AAAAGTATATTGTGTTCGTGTGAGTGTATTATTTTGCCAATTGAACCACATAAGTATGGAAAGCATTAGC CCTAATTGAACGTCCTGCACATCGAAACATGAGTAACTCTACAAAACTACTCTGATTAACAGATATTTGT GTACAAATTATTGTGTTGAAGAAACAAAACTTTCACCTCATTTTGTTGAGTCTCTTCTTCCGATTTGTTC AAACTCTCTAAGTTTTTGAAATATCTTTTCATAGTGGTACTAAATAATCGATTGAATTTTATCAGCATTT TCGTATTCTTTTTGTATTATTAAAACAATAAGCTTTCAGTTTTCAATTCTGAATTTGATCACGAATAGAG GAATTTGAATTTTTACTGGGAAGGAAGCAATTAAATCAAATCGAAATTATTACCAAAATAGCAAACAAAG GTCACAGTCAGTTGGGTCAGGTCAATAGGATTTGAAAAGACGATAGCGAACATTCAAATAGTTGAAATCT AGCCACAGTTTTCACTTTTTTCACAGTTTCAAAATAGATAAATGTTACTCTGAAAATAAAAATGCCAGAA ATGTATACAAGCAAAGCTACGGGTTACCGAAGAGAGAGTAAAAGGTACTCTATACGTACTAACATGTTAT GTTTAATTACTTTCTATTTCAGGTACACTTTTTAAAGTACACTTTAAAATTGATATCTGCTTAGTACAAA TCTAAAGCTAACTACGAAAACATCTAAGATTCTGTCTAGTTTCAAATATGTGATTTTCTTTTAGATTTGT TGTAAATAATGTCGGGTTTTTTCTTTCAGTTATTTTGATGCGTGGTACGAGTTAAATTTATTCTAAGTAT TTACACAAATTACATTAATAGTAGGTACATGTTTAATTTAATTTGTTAGTTCTAATTTTTGTGTTAGTAG CAGCTGATTTTAAATGTGTGCTTGTGTTATTGATATTGATATTGTTAATGTCATTGTTAATGTTATTGTT ATTGTAATTGTGTTTGTGTTTGTACGTTATGCATGTTTTTAATGAAATTTTTAATCGAAAACGAAAACAA AAACAAAAAAAAATAAATATGTTTGAATGCGGTTAGAGAAGAATAAGAGTGTTACAAATTTGACAATTTT GTGCAATACCTCCCGAATCCGCTGTCGATCTGTCTTTTTTACGCTTTTTCTTTTTTGACACGTAACCGTA GTTATCTCGTGCGCTCCACCCCGGATACAACTCCATATGCAATTGGCGCTCTTGTCGCGCTTTTTCGTAA TATTTGCTTTGCTCTTCGCGGGAAAGTTCGTGCCACTACAAAAGTATTATTAATGTTGGGAATCAGTTAG CATTAACTTATAAAACGAGTGTTTTTGCATTGAGAATAATGTCAAGGTGAGTTCAATATGCATATTTTAT ATATAGTTAATTTCTTTGTGCGAATTCCAATAGTACTTATATACATATGTGTCCGTGTGTCCGTCCGTCT GTCCTTTAATAATCGAAGATTATTTGCGCTAAAGAAGCATTCGCAGCATTAAAAACTGTTCCGGTAATCG AGGCTTGTTTATAAAATGAACCCCCATCATAAAACTTAACCGGATTAACCAGAAAACATGACTTGGCAGC CAAGTTAAAGGTAAAGGACAGCATTACGATGGACTATGTAGCTTACCCGTCGCCCCAGTATTTGATTAAT CGCCGCTGACTCTTTCAGGGTGCATTCAGCTACAACTTTGGCTCTCATCTCTTTCATGTACAGCATAAAT GCGTTCAGAGGTTTCTTGATATGTGGCTTCTTTTTATCATTTGAACTATCTTTACAGTCGTTTGCTTGCG AATTTGATGAGCTTTTGGTATCCAAGTTTCTGAAATTAATCAACAAGCAGAAGTATAATCATTCTCCATT CACAAACAAAAATAATGTACAATTTATTGATAACAAATAAAAACTATAATTCAAATATTCTTGCAGCAGA TATAAAAATTGGCATGTGTGTTTTCACATATTACATATATTTCAAATATTTTTTTTGAAGCCAAATATCG GACAAGAATCAATCAATATTGCAAATTATTTAAGTGCAAATTACGTCTTGACAACCTTAGGAATGTCTTA TTTCTCTGTTGGCACGAAAGGACACACCTCCGACCAGTAACAACAACCGAGTAGATATAGCTATCTTCTT CTGGATGTTTTTAAAGATTATTAATAAATATCTTCCAAGAAATGATGGAAAAATAAGAAAAACTTTTTTA AATAAATATCTTGACCAAAGTCGCAGACTAAAGCTCTTACACTTTTTATTTTGTGTAACAAAACTAATTT TAAATTTACATTTTTTTTAGCCTCGTTCCAATGCTTAAGTCGTAGGGAGTGTCAGATCCAGCTCCAAGTC CTGATTCGCTTCCACATCCAGTTGCAATTCCAGCCGCCACTGTCAAAGCGCTAAACTGGGCCTTAAACAT GTCCGTAATGGCACGTTCCTGGAATGCGGCTACCGCCGCAACGGCTGAGGGTGAATCTTGAATGGGGGCC GCTGCGGCTGAGGCGGAGCCGGAGGCTGACGCGGTTGTCGATGATACCGAGGATGGGCACATTGGCATAC TGGCAATAGCGACAACCTTATATGCGTCCCCGTTGAGTTCCTTGGCCGAGTACTCCGGCTGGCAGGTGCT GGCCGATGATGAGGATGTGGGAGTTTCGATGCGTCGCGCATATCTAGATTTTCGCCGGTGGTTATATTTA CTCGTGCTCAAAGAATACGATGTGCAGCCAAGCGGGCCCGTAACTGTCGAACAGCTGCTGTTGCTACTTG TTGGTGGTGTGGCTGGCGTTGGAGGGAACGGAATATCGGCCAAGTATAAGGGATCCGAAGTGGCCGACTC TCGATTAAACGGTGCTCTCTGCGTCCCTGGTGATAGATTCAAGACCGAACAGTTCTCGGCGATTTTGTTA GTACTTGAACCAGAGCCAGGCAGAGGCAAGCTGTTGCCACTGCCCATCAATGCATTAATTTTCGCCTGCA CCGACGATAACGAAGTATATTCCAAAAGAATTTCGGCGGCAGTGCTGCAGGTGTCACCGTCATCGGCTGG ATGAACATTGTTCTTTGGATGCCAAATACAAGCGGGTGATGATGACTCTTTTTCTTCGTCGCTATCACTG CTCGCTGCACTTTCGCTGTGGCCATTCACGAAACCTGGGTCAGATTGTTTCTGTTGACTAGCAGCAGCGG CTGCTGCTTGCTGCAGTATAATATTTTCAATATCTTGCAGTGTACGCAGTTTCTCTGGCGATGAATGTAC TTCGGGTTTACTTGAGCAGTTGTTCTCTTGCCTATAGCAGTTTTTTGGGCTAACTTCGGCGGCATCAGTT TTGTTTCTTAACCCTGAATCGCATTCGGCAGACAAGGCAATCGCAGCAAGGGCCATAACATCATGAGTGG GAGAATCGGGCTTGCTGCCAGGAGTAAGGCCTAGTCTCTGCAAGCTCCGTAGATAATAGAGTTCAGCACT GCTCCACTGACGATAAAGACTTCTCACTTGGACCAACATGCCTTCGATTTTCAATCGATTGTTTTCCAAT TCGCGTTGTACGGTAACTTCAAGGGTCGAGGTCGAGGTCGAGGTGTTTGTATTGTCATCATCAGGTCTGT CTGCCCTTTCATCTGGCATACTTAGACTATCCTGAAATTGACTGCAAAGTAATGTCAATTGCTCTAGGCC CTTTTTTATATCAAACAATACGTTCTTCTGCTCGCGCAAAAAGAAGCCCTTCGAGCTTGAAGCGCATTGA GCTATTGTGCGTTTGCTTAACTTGCATTTGTCTTTAGTCGATGAGTTCGAATTCGAGTTGTGTGCATCTG TTCCATCTCTCCGGATGTGGTCGTGATCATATCGAACACTCTGTTCGATATCGCTTTGTGTTCGATTATT GTTGTTATCGTGTGATAAGCCAATTGATAGTGATGATGTTGACAATAATGGTGTTGCTTTTGGCTCATTG CTAACGGAAGATTTTCGCAAACCAGAAAACTCCAATATATGTAGCCTACGTTCTCGCTCCTGATCGACCT CCAATGACAAATGGGGCTGATGTAGAAACTGTGCATAAAGCAATTGTGTTGCTAGAAACTGTCTTTGCTG CTGCTGCTGCTGCTGTTGCTGCTGTTGCTGGCGTTGTGTGCTCTTGTGCTGGGAGAGCACTTTATTGTTG TATATGCGCGCCAGTAATGCATCACGATTGCAGCTTGTATCCAATTGCTCCCGATTCCATTTGCGCTGAG GGTCCTCCAGCTTTGGCCAGTGCTGGAGCATGTCGTGCTGCTGCCGCAATAGAATTTCCGACATTATTGT GGATGTTGTAGTCGGCACCACCGCATTGCTTGTGGGTGTATTAAATATGTGCTCCATCACATCCGAGTTG ACCTTGGTAACTGCCTCATTCGTGGTCTGTTGATGATCAAAGAATTGTGCATTCGGGACAGTTGTTGTTG TCGATGATGATGATGACGATTGCGAGATCGTTTCCATTATATTGCCAACGGGAATGGAAAAGTCCTTCGG CTCCTTATTCTCTTCGGCGCTTTCATTTCCATTTAGGTGCATTTGTCTATAACTATTTGACTCTCTTCTA GGGGATAGCGCTTCTGAAGTATCATCTAATCTGCCGCTTTTACTGTTGCTCTTGGTATTCTTGGCAATTT TATTATCCATAGCAATGCAGGTATTCGAATTATCCGGAGGTCATAGCCTTTCTCGCGCTGCTGTCGATGC CGTTAAATGATTTTAAATACGTTTACATTCACTTCAGAGTTTAATAACTCCACCCATGGTCGAGACATTT AAATTTTGTTTGATACTCCACTCTATTTCAAATATATTTAATGTTTTTATTTCGATTAGAAGACAATCGG AAAAAGATGATATCAAAGTTTTATACGTTTCTAGAGTTCACAAAACTAAACTTGTAAAAATAGTAAGCGT TTTGCCGTATTCTAATACCATTAAGCATTCAGTGCCCTAAAAATGGGTACATTGAAAGAGCTGGAAATGT TTTGAAAACTATACTGTATGTAGCTCAGTAAAATGTAATAATATATCCTAGCTGACCCGTTCACAACTCG AATCATAAATACAGAGTATCTGCTTGTAAGTATTGTCGATGTGCTGCCATATTCTATTTTGATTCTTTGG GTTTTGGCACAACAAATAAAAATAAATCTATGGGAGAGCCAAATTTGTATTTGTATAGATTCCACTTTGA CCTGCTATGATGAATTTTTATTCTTGACCTACACCACCCTCTGCCACAATTGAGATTTACTGAAGTAATT TCCTTGACTGAGTAGTTAGTAAATCTATATTCTTCTCGTGTGGATTTTTTTTAAATAAAGCCCTCTCACG AGCACAGAAACATTAGCTTTTACTACACACTGTTTACAAGATATAAAGAGTCGATAAGTTTTAGTGTACT CGTGTATTCGCAACTTAGGTAGTGTTTATATTTTGGTGGGATTATTTGACAGGCTTTATACTGCACATTG TCAACAGGGTATGGCGCACTCGGTTGCCACTGACGGCAAGGCAACGTCGTTCTTAGACTCCGGCTCTCGT CATTGAGGCAACAGACAGGCGCACTAACCATAACAACGATAACCCTGTTGCCTGCCTGTTGCAGATTTGA ATAAGAGAATATGCACACATTTGATATGTGTATGTACACATGCGAGTATCTCCATCAAAATTTAACAATT TATGTATTTCAATAGCATTTCATATTATGCCTGGTCCAAAATTTCACCGATTATCACACGCTTAACGGG
It gives me output as: <code> range: 39761 .. 39960 A:58 C:35 (35+32) GC*100/58+73+32+35 G:32 T:73 range: 39762 .. 39961 A:57 C:36 (36+32) GC*100/57+73+32+36 G:32 T:73 range: 39763 .. 39962 A:57 C:36 (36+32) GC*100/57+73+32+36 G:32 T:73 range: 39764 .. 39963 A:57 C:35 (35+33) GC*100/57+73+33+35 G:33 T:73 range: 39765 .. 39964 A:57 C:35 (35+33) GC*100/57+73+33+35 G:33 T:73 range: 39766 .. 39965 A:58 C:35 (35+33) GC*100/58+72+33+35 G:33 T:72 range: 39767 .. 39966 A:57 C:35 (35+34) GC*100/57+72+34+35 G:34 T:72 range: 39768 .. 39967 A:56 C:35 (35+34) GC*100/56+73+34+35 G:34 T:73 range: 39769 .. 39968 A:56 C:35 (35+34) GC*100/56+73+34+35 G:34 T:73 range: 39770 .. 39969 A:57 C:35 (35+34) GC*100/57+72+34+35 G:34 T:72 range: 39771 .. 39970 A:56 C:35 (35+34) GC*100/56+73+34+35 G:34 T:73 range: 39772 .. 39971 A:56 C:34 (34+34) GC*100/56+74+34+34 G:34 T:74 range: 39773 .. 39972 A:55 C:34 (34+34) GC*100/55+74+34+34 G:34 T:74 range: 39774 .. 39973 A:55 C:34 (34+33) GC*100/55+75+33+34 G:33 T:75 range: 39775 .. 39974 A:54 C:35 (35+33) GC*100/54+75+33+35 G:33 T:75 range: 39776 .. 39975 A:54 C:36 (36+32) GC*100/54+75+32+36 G:32 T:75 range: 39777 .. 39976 A:54 C:36 (36+32) GC*100/54+75+32+36 G:32 T:75 range: 39778 .. 39977 A:53 C:36 (36+32) GC*100/53+76+32+36 G:32 T:76 range: 39779 .. 39978 A:53 C:36 (36+33) GC*100/53+75+33+36 G:33 T:75 range: 39780 .. 39979 A:54 C:35 (35+33) GC*100/54+75+33+35 G:33 T:75 range: 39781 .. 39980 A:54 C:36 (36+33) GC*100/54+74+33+36 G:33 T:74 range: 39782 .. 39981 A:54 C:36 (36+32) GC*100/54+75+32+36 G:32 T:75 range: 39783 .. 39982 A:54 C:35 (35+33) GC*100/54+75+33+35 G:33 T:75 range: 39784 .. 39983 A:55 C:35 (35+33) GC*100/55+74+33+35 G:33 T:74 range: 39785 .. 39984 A:55 C:35 (35+34) GC*100/55+73+34+35 G:34 T:73 range: 39786 .. 39985 A:55 C:35 (35+33) GC*100/55+74+33+35 G:33 T:74 range: 39787 .. 39986 A:56 C:35 (35+33) GC*100/56+73+33+35 G:33 T:73 range: 39788 .. 39987 A:55 C:35 (35+34) GC*100/55+73+34+35 G:34 T:73 range: 39789 .. 39988 A:54 C:35 (35+34) GC*100/54+74+34+35 G:34 T:74 range: 39790 .. 39989 A:54 C:35 (35+33) GC*100/54+75+33+35 G:33 T:75 range: 39791 .. 39990 A:55 C:35 (35+33) GC*100/55+74+33+35 G:33 T:74 range: 39792 .. 39991 A:54 C:35 (35+34) GC*100/54+74+34+35 G:34 T:74 range: 39793 .. 39992 A:54 C:35 (35+34) GC*100/54+74+34+35 G:34 T:74 range: 39794 .. 39993 A:55 C:35 (35+34) GC*100/55+73+34+35 G:34 T:73 range: 39795 .. 39994 A:56 C:35 (35+33) GC*100/56+73+33+35 G:33 T:73 range: 39796 .. 39995 A:57 C:35 (35+33) GC*100/57+72+33+35 G:33 T:72 range: 39797 .. 39996 A:57 C:34 (34+33) GC*100/57+73+33+34 G:33 T:73 range: 39798 .. 39997 A:57 C:35 (35+32) GC*100/57+73+32+35 G:32 T:73 range: 39799 .. 39998 A:56 C:35 (35+32) GC*100/56+74+32+35 G:32 T:74 range: 39800 .. 39999 A:57 C:35 (35+32) GC*100/57+73+32+35 G:32 T:73 range: 39801 .. 40000 A:57 C:35 (35+31) GC*100/57+74+31+35 G:31 T:74 range: 39802 .. 40001 A:58 C:35 (35+31) GC*100/58+73+31+35 G:31 T:73 range: 39803 .. 40002 A:58 C:35 (35+30) GC*100/58+74+30+35 G:30 T:74 range: 39804 .. 40003 A:58 C:34 (34+30) GC*100/58+75+30+34 G:30 T:75 range: 39805 .. 40004 A:58 C:35 (35+30) GC*100/58+74+30+35 G:30 T:74 range: 39806 .. 40005 A:58 C:35 (35+29) GC*100/58+75+29+35 G:29 T:75 range: 39807 .. 40006 A:58 C:34 (34+29) GC*100/58+76+29+34 G:29 T:76 range: 39808 .. 40007 A:58 C:34 (34+29) GC*100/58+76+29+34 G:29 T:76 range: 39809 .. 40008 A:57 C:34 (34+29) GC*100/57+77+29+34 G:29 T:77 range: 39810 .. 40009 A:57 C:35 (35+29) GC*100/57+76+29+35 G:29 T:76 range: 39811 .. 40010 A:56 C:35 (35+30) GC*100/56+76+30+35 G:30 T:76 range: 39812 .. 40011 A:56 C:35 (35+30) GC*100/56+76+30+35 G:30 T:76 range: 39813 .. 40012 A:56 C:35 (35+31) GC*100/56+75+31+35 G:31 T:75 range: 39814 .. 40013 A:56 C:34 (34+31) GC*100/56+76+31+34 G:31 T:76 range: 39815 .. 40014 A:56 C:34 (34+32) GC*100/56+75+32+34 G:32 T:75 range: 39816 .. 40015 A:55 C:34 (34+33) GC*100/55+75+33+34 G:33 T:75 range: 39817 .. 40016 A:56 C:34 (34+33) GC*100/56+74+33+34 G:33 T:74 range: 39818 .. 40017 A:56 C:34 (34+33) GC*100/56+74+33+34 G:33 T:74 range: 39819 .. 40018 A:56 C:34 (34+33) GC*100/56+74+33+34 G:33 T:74 range: 39820 .. 40019 A:56 C:34 (34+33) GC*100/56+74+33+34 G:33 T:74 range: 39821 .. 40020 A:56 C:34 (34+32) GC*100/56+75+32+34 G:32 T:75 range: 39822 .. 40021 A:55 C:34 (34+32) GC*100/55+76+32+34 G:32 T:76 range: 39823 .. 40022 A:55 C:34 (34+32) GC*100/55+76+32+34 G:32 T:76 range: 39824 .. 40023 A:55 C:34 (34+32) GC*100/55+76+32+34 G:32 T:76 range: 39825 .. 40024 A:55 C:33 (33+32) GC*100/55+77+32+33 G:32 T:77 range: 39826 .. 40025 A:56 C:33 (33+32) GC*100/56+76+32+33 G:32 T:76 range: 39827 .. 40026 A:57 C:33 (33+32) GC*100/57+75+32+33 G:32 T:75 range: 39828 .. 40027 A:58 C:33 (33+32) GC*100/58+74+32+33 G:32 T:74 range: 39829 .. 40028 A:58 C:33 (33+31) GC*100/58+75+31+33 G:31 T:75 range: 39830 .. 40029 A:59 C:33 (33+30) GC*100/59+75+30+33 G:30 T:75 range: 39831 .. 40030 A:60 C:33 (33+30) GC*100/60+75+30+33 G:30 T:75 range: 39832 .. 40031 A:61 C:33 (33+29) GC*100/61+75+29+33 G:29 T:75 range: 39833 .. 40032 A:61 C:33 (33+30) GC*100/61+74+30+33 G:30 T:74 range: 39834 .. 40033 A:61 C:34 (34+30) GC*100/61+73+30+34 G:30 T:73 range: 39835 .. 40034 A:61 C:35 (35+30) GC*100/61+72+30+35 G:30 T:72 range: 39836 .. 40035 A:61 C:36 (36+30) GC*100/61+71+30+36 G:30 T:71 range: 39837 .. 40036 A:61 C:36 (36+29) GC*100/61+72+29+36 G:29 T:72 range: 39838 .. 40037 A:61 C:37 (37+28) GC*100/61+72+28+37 G:28 T:72 range: 39839 .. 40038 A:61 C:36 (36+28) GC*100/61+73+28+36 G:28 T:73 range: 39840 .. 40039 A:60 C:37 (37+28) GC*100/60+73+28+37 G:28 T:73 range: 39841 .. 40040 A:61 C:36 (36+28) GC*100/61+73+28+36 G:28 T:73 range: 39842 .. 40041 A:60 C:37 (37+28) GC*100/60+73+28+37 G:28 T:73 range: 39843 .. 40042 A:59 C:37 (37+29) GC*100/59+73+29+37 G:29 T:73 range: 39844 .. 40043 A:59 C:36 (36+29) GC*100/59+73+29+36 G:29 T:73 range: 39845 .. 40044 A:59 C:36 (36+29) GC*100/59+73+29+36 G:29 T:73 range: 39846 .. 40045 A:58 C:36 (36+30) GC*100/58+73+30+36 G:30 T:73 range: 39847 .. 40046 A:57 C:37 (37+30) GC*100/57+73+30+37 G:30 T:73 range: 39848 .. 40047 A:58 C:37 (37+30) GC*100/58+72+30+37 G:30 T:72 range: 39849 .. 40048 A:57 C:38 (38+30) GC*100/57+72+30+38 G:30 T:72 range: 39850 .. 40049 A:57 C:38 (38+30) GC*100/57+72+30+38 G:30 T:72 range: 39851 .. 40050 A:56 C:38 (38+31) GC*100/56+72+31+38 G:31 T:72 range: 39852 .. 40051 A:56 C:38 (38+31) GC*100/56+72+31+38 G:31 T:72 range: 39853 .. 40052 A:56 C:38 (38+31) GC*100/56+72+31+38 G:31 T:72 range: 39854 .. 40053 A:57 C:38 (38+31) GC*100/57+71+31+38 G:31 T:71 range: 39855 .. 40054 A:56 C:39 (39+31) GC*100/56+71+31+39 G:31 T:71 range: 39856 .. 40055 A:56 C:39 (39+31) GC*100/56+71+31+39 G:31 T:71 range: 39857 .. 40056 A:55 C:39 (39+31) GC*100/55+72+31+39 G:31 T:72 range: 39858 .. 40057 A:55 C:39 (39+31) GC*100/55+72+31+39 G:31 T:72 range: 39859 .. 40058 A:56 C:38 (38+31) GC*100/56+72+31+38 G:31 T:72 range: 39860 .. 40059 A:56 C:38 (38+32) GC*100/56+71+32+38 G:32 T:71 range: 39861 .. 40060 A:55 C:39 (39+32) GC*100/55+71+32+39 G:32 T:71 range: 39862 .. 40061 A:55 C:39 (39+32) GC*100/55+71+32+39 G:32 T:71 range: 39863 .. 40062 A:55 C:39 (39+31) GC*100/55+72+31+39 G:31 T:72 range: 39864 .. 40063 A:55 C:39 (39+30) GC*100/55+73+30+39 G:30 T:73 range: 39865 .. 40064 A:55 C:39 (39+29) GC*100/55+74+29+39 G:29 T:74 range: 39866 .. 40065 A:55 C:39 (39+29) GC*100/55+74+29+39 G:29 T:74 range: 39867 .. 40066 A:55 C:40 (40+28) GC*100/55+74+28+40 G:28 T:74 range: 39868 .. 40067 A:54 C:40 (40+28) GC*100/54+75+28+40 G:28 T:75 range: 39869 .. 40068 A:55 C:40 (40+27) GC*100/55+75+27+40 G:27 T:75 range: 39870 .. 40069 A:55 C:40 (40+27) GC*100/55+75+27+40 G:27 T:75 range: 39871 .. 40070 A:56 C:39 (39+27) GC*100/56+75+27+39 G:27 T:75 range: 39872 .. 40071 A:55 C:40 (40+27) GC*100/55+75+27+40 G:27 T:75 range: 39873 .. 40072 A:55 C:40 (40+27) GC*100/55+75+27+40 G:27 T:75 range: 39874 .. 40073 A:54 C:41 (41+27) GC*100/54+75+27+41 G:27 T:75 range: 39875 .. 40074 A:54 C:41 (41+27) GC*100/54+75+27+41 G:27 T:75 range: 39876 .. 40075 A:54 C:41 (41+28) GC*100/54+74+28+41 G:28 T:74 range: 39877 .. 40076 A:54 C:41 (41+28) GC*100/54+74+28+41 G:28 T:74 range: 39878 .. 40077 A:54 C:41 (41+27) GC*100/54+75+27+41 G:27 T:75 range: 39879 .. 40078 A:54 C:41 (41+27) GC*100/54+75+27+41 G:27 T:75 range: 39880 .. 40079 A:54 C:41 (41+27) GC*100/54+75+27+41 G:27 T:75 range: 39881 .. 40080 A:54 C:42 (42+27) GC*100/54+74+27+42 G:27 T:74 range: 39882 .. 40081 A:55 C:42 (42+27) GC*100/55+73+27+42 G:27 T:73 range: 39883 .. 40082 A:56 C:42 (42+27) GC*100/56+72+27+42 G:27 T:72 range: 39884 .. 40083 A:56 C:42 (42+27) GC*100/56+72+27+42 G:27 T:72 range: 39885 .. 40084 A:57 C:42 (42+27) GC*100/57+71+27+42 G:27 T:71 range: 39886 .. 40085 A:56 C:42 (42+27) GC*100/56+72+27+42 G:27 T:72 range: 39887 .. 40086 A:57 C:42 (42+27) GC*100/57+71+27+42 G:27 T:71 range: 39888 .. 40087 A:56 C:42 (42+27) GC*100/56+72+27+42 G:27 T:72 range: 39889 .. 40088 A:57 C:42 (42+26) GC*100/57+72+26+42 G:26 T:72 range: 39890 .. 40089 A:57 C:42 (42+26) GC*100/57+72+26+42 G:26 T:72 range: 39891 .. 40090 A:58 C:42 (42+26) GC*100/58+71+26+42 G:26 T:71 range: 39892 .. 40091 A:58 C:42 (42+27) GC*100/58+70+27+42 G:27 T:70 range: 39893 .. 40092 A:59 C:41 (41+27) GC*100/59+70+27+41 G:27 T:70 range: 39894 .. 40093 A:59 C:40 (40+28) GC*100/59+70+28+40 G:28 T:70 range: 39895 .. 40094 A:58 C:40 (40+28) GC*100/58+71+28+40 G:28 T:71 range: 39896 .. 40095 A:58 C:40 (40+28) GC*100/58+71+28+40 G:28 T:71 range: 39897 .. 40096 A:58 C:40 (40+29) GC*100/58+70+29+40 G:29 T:70 range: 39898 .. 40097 A:59 C:40 (40+29) GC*100/59+69+29+40 G:29 T:69 range: 39899 .. 40098 A:59 C:40 (40+29) GC*100/59+69+29+40 G:29 T:69 range: 39900 .. 40099 A:60 C:40 (40+28) GC*100/60+69+28+40 G:28 T:69 range: 39901 .. 40100 A:60 C:40 (40+28) GC*100/60+69+28+40 G:28 T:69 range: 39902 .. 40101 A:60 C:40 (40+29) GC*100/60+69+29+40 G:29 T:69 range: 39903 .. 40102 A:60 C:39 (39+29) GC*100/60+70+29+39 G:29 T:70 range: 39904 .. 40103 A:60 C:38 (38+29) GC*100/60+71+29+38 G:29 T:71 range: 39905 .. 40104 A:60 C:38 (38+29) GC*100/60+71+29+38 G:29 T:71 range: 39906 .. 40105 A:60 C:38 (38+28) GC*100/60+72+28+38 G:28 T:72 range: 39907 .. 40106 A:61 C:37 (37+28) GC*100/61+72+28+37 G:28 T:72 range: 39908 .. 40107 A:61 C:37 (37+29) GC*100/61+71+29+37 G:29 T:71 range: 39909 .. 40108 A:60 C:37 (37+29) GC*100/60+72+29+37 G:29 T:72 range: 39910 .. 40109 A:60 C:37 (37+30) GC*100/60+71+30+37 G:30 T:71 range: 39911 .. 40110 A:60 C:37 (37+29) GC*100/60+72+29+37 G:29 T:72 range: 39912 .. 40111 A:60 C:37 (37+29) GC*100/60+72+29+37 G:29 T:72 range: 39913 .. 40112 A:60 C:38 (38+29) GC*100/60+71+29+38 G:29 T:71 range: 39914 .. 40113 A:60 C:38 (38+28) GC*100/60+72+28+38 G:28 T:72 range: 39915 .. 40114 A:59 C:38 (38+28) GC*100/59+72+28+38 G:28 T:72 range: 39916 .. 40115 A:58 C:39 (39+28) GC*100/58+72+28+39 G:28 T:72 range: 39917 .. 40116 A:58 C:39 (39+29) GC*100/58+71+29+39 G:29 T:71 range: 39918 .. 40117 A:58 C:39 (39+29) GC*100/58+71+29+39 G:29 T:71 range: 39919 .. 40118 A:58 C:39 (39+30) GC*100/58+70+30+39 G:30 T:70 range: 39920 .. 40119 A:58 C:39 (39+30) GC*100/58+70+30+39 G:30 T:70 range: 39921 .. 40120 A:59 C:39 (39+30) GC*100/59+69+30+39 G:30 T:69 range: 39922 .. 40121 A:58 C:39 (39+30) GC*100/58+70+30+39 G:30 T:70 range: 39923 .. 40122 A:58 C:39 (39+30) GC*100/58+70+30+39 G:30 T:70 range: 39924 .. 40123 A:58 C:40 (40+30) GC*100/58+69+30+40 G:30 T:69 range: 39925 .. 40124 A:58 C:39 (39+31) GC*100/58+69+31+39 G:31 T:69 range: 39926 .. 40125 A:58 C:40 (40+31) GC*100/58+68+31+40 G:31 T:68 range: 39927 .. 40126 A:59 C:40 (40+31) GC*100/59+67+31+40 G:31 T:67 range: 39928 .. 40127 A:60 C:40 (40+30) GC*100/60+67+30+40 G:30 T:67 range: 39929 .. 40128 A:59 C:41 (41+30) GC*100/59+67+30+41 G:30 T:67 range: 39930 .. 40129 A:59 C:40 (40+30) GC*100/59+68+30+40 G:30 T:68 range: 39931 .. 40130 A:59 C:39 (39+30) GC*100/59+69+30+39 G:30 T:69 range: 39932 .. 40131 A:60 C:39 (39+30) GC*100/60+68+30+39 G:30 T:68 range: 39933 .. 40132 A:59 C:39 (39+31) GC*100/59+68+31+39 G:31 T:68 range: 39934 .. 40133 A:59 C:38 (38+32) GC*100/59+68+32+38 G:32 T:68 range: 39935 .. 40134 A:58 C:38 (38+32) GC*100/58+69+32+38 G:32 T:69 range: 39936 .. 40135 A:59 C:37 (37+32) GC*100/59+69+32+37 G:32 T:69 range: 39937 .. 40136 A:59 C:36 (36+33) GC*100/59+69+33+36 G:33 T:69 range: 39938 .. 40137 A:58 C:36 (36+33) GC*100/58+70+33+36 G:33 T:70 range: 39939 .. 40138 A:58 C:35 (35+34) GC*100/58+70+34+35 G:34 T:70 range: 39940 .. 40139 A:58 C:34 (34+34) GC*100/58+71+34+34 G:34 T:71 range: 39941 .. 40140 A:58 C:33 (33+34) GC*100/58+72+34+33 G:34 T:72 range: 39942 .. 40141 A:58 C:33 (33+34) GC*100/58+72+34+33 G:34 T:72 range: 39943 .. 40142 A:59 C:32 (32+34) GC*100/59+72+34+32 G:34 T:72 range: 39944 .. 40143 A:59 C:32 (32+34) GC*100/59+72+34+32 G:34 T:72 range: 39945 .. 40144 A:60 C:32 (32+33) GC*100/60+72+33+32 G:33 T:72 range: 39946 .. 40145 A:60 C:31 (31+33) GC*100/60+73+33+31 G:33 T:73 range: 39947 .. 40146 A:60 C:30 (30+33) GC*100/60+74+33+30 G:33 T:74 range: 39948 .. 40147 A:59 C:30 (30+33) GC*100/59+75+33+30 G:33 T:75 range: 39949 .. 40148 A:59 C:29 (29+33) GC*100/59+76+33+29 G:33 T:76 range: 39950 .. 40149 A:58 C:29 (29+34) GC*100/58+76+34+29 G:34 T:76 range: 39951 .. 40150 A:57 C:29 (29+35) GC*100/57+76+35+29 G:35 T:76 range: 39952 .. 40151 A:57 C:29 (29+35) GC*100/57+76+35+29 G:35 T:76 range: 39953 .. 40152 A:57 C:29 (29+36) GC*100/57+75+36+29 G:36 T:75 range: 39954 .. 40153 A:57 C:29 (29+36) GC*100/57+75+36+29 G:36 T:75 range: 39955 .. 40154 A:56 C:29 (29+37) GC*100/56+75+37+29 G:37 T:75 range: 39956 .. 40155 A:57 C:29 (29+36) GC*100/57+75+36+29 G:36 T:75 range: 39957 .. 40156 A:56 C:29 (29+36) GC*100/56+76+36+29 G:36 T:76 range: 39958 .. 40157 A:56 C:29 (29+36) GC*100/56+76+36+29 G:36 T:76 range: 39959 .. 40158 A:57 C:29 (29+36) GC*100/57+75+36+29 G:36 T:75 range: 39960 .. 40159 A:57 C:29 (29+36) GC*100/57+75+36+29 G:36 T:75 range: 39961 .. 40160 A:56 C:29 (29+36) GC*100/56+76+36+29 G:36 T:76 range: 39962 .. 40161 A:56 C:28 (28+36) GC*100/56+77+36+28 G:36 T:77 range: 39963 .. 40162 A:56 C:28 (28+37) GC*100/56+76+37+28 G:37 T:76 range: 39964 .. 40163 A:57 C:28 (28+36) GC*100/57+76+36+28 G:36 T:76 range: 39965 .. 40164 A:56 C:29 (29+36) GC*100/56+76+36+29 G:36 T:76 range: 39966 .. 40165 A:56 C:29 (29+36) GC*100/56+76+36+29 G:36 T:76 range: 39967 .. 40166 A:56 C:29 (29+36) GC*100/56+76+36+29 G:36 T:76 range: 39968 .. 40167 A:56 C:29 (29+37) GC*100/56+75+37+29 G:37 T:75 range: 39969 .. 40168 A:55 C:30 (30+37) GC*100/55+75+37+30 G:37 T:75 range: 39970 .. 40169 A:54 C:30 (30+37) GC*100/54+76+37+30 G:37 T:76 range: 39971 .. 40170 A:54 C:30 (30+37) GC*100/54+76+37+30 G:37 T:76 range: 39972 .. 40171 A:54 C:30 (30+37) GC*100/54+76+37+30 G:37 T:76 range: 39973 .. 40172 A:55 C:30 (30+37) GC*100/55+76+37+30 G:37 T:76 range: 39974 .. 40173 A:55 C:30 (30+37) GC*100/55+76+37+30 G:37 T:76 range: 39975 .. 40174 A:56 C:29 (29+37) GC*100/56+76+37+29 G:37 T:76 range: 39976 .. 40175 A:56 C:29 (29+37) GC*100/56+76+37+29 G:37 T:76 range: 39977 .. 40176 A:56 C:29 (29+37) GC*100/56+76+37+29 G:37 T:76 range: 39978 .. 40177 A:56 C:29 (29+38) GC*100/56+75+38+29 G:38 T:75 range: 39979 .. 40178 A:56 C:30 (30+37) GC*100/56+75+37+30 G:37 T:75 range: 39980 .. 40179 A:56 C:30 (30+37) GC*100/56+75+37+30 G:37 T:75 range: 39981 .. 40180 A:56 C:30 (30+37) GC*100/56+75+37+30 G:37 T:75 range: 39982 .. 40181 A:57 C:30 (30+37) GC*100/57+74+37+30 G:37 T:74 range: 39983 .. 40182 A:57 C:30 (30+36) GC*100/57+75+36+30 G:36 T:75 range: 39984 .. 40183 A:56 C:30 (30+36) GC*100/56+76+36+30 G:36 T:76 range: 39985 .. 40184 A:56 C:30 (30+36) GC*100/56+76+36+30 G:36 T:76 range: 39986 .. 40185 A:56 C:30 (30+36) GC*100/56+75+36+30 G:36 T:75 range: 39987 .. 40186 A:55 C:30 (30+36) GC*100/55+76+36+30 G:36 T:76 range: 39988 .. 40187 A:55 C:31 (31+35) GC*100/55+76+35+31 G:35 T:76 range: 39989 .. 40188 A:56 C:31 (31+35) GC*100/56+75+35+31 G:35 T:75 range: 39990 .. 40189 A:57 C:31 (31+35) GC*100/57+74+35+31 G:35 T:74 range: 39991 .. 40190 A:56 C:32 (32+35) GC*100/56+74+35+32 G:35 T:74 range: 39992 .. 40191 A:57 C:32 (32+34) GC*100/57+74+34+32 G:34 T:74 range: 39993 .. 40192 A:57 C:32 (32+35) GC*100/57+73+35+32 G:35 T:73 range: 39994 .. 40193 A:56 C:32 (32+36) GC*100/56+73+36+32 G:36 T:73 range: 39995 .. 40194 A:55 C:32 (32+37) GC*100/55+73+37+32 G:37 T:73 range: 39996 .. 40195 A:54 C:32 (32+37) GC*100/54+74+37+32 G:37 T:74 range: 39997 .. 40196 A:55 C:32 (32+37) GC*100/55+73+37+32 G:37 T:73 range: 39998 .. 40197 A:55 C:31 (31+37) GC*100/55+74+37+31 G:37 T:74 range: 39999 .. 40198 A:55 C:31 (31+38) GC*100/55+73+38+31 G:38 T:73 range: 40000 .. 40199 A:54 C:31 (31+39) GC*100/54+73+39+31 G:39 T:73 range: 40001 .. 40200 A:54 C:32 (32+39) GC*100/54+72+39+32 G:39 T:72 range: 40002 .. 40201 A:53 C:32 (32+40) GC*100/53+72+40+32 G:40 T:72 range: 40003 .. 40202 A:53 C:33 (33+40) GC*100/53+71+40+33 G:40 T:71 range: 40004 .. 40203 A:54 C:33 (33+40) GC*100/54+70+40+33 G:40 T:70 range: 40005 .. 40204 A:54 C:33 (33+40) GC*100/54+70+40+33 G:40 T:70 range: 40006 .. 40205 A:54 C:33 (33+40) GC*100/54+70+40+33 G:40 T:70 range: 40007 .. 40206 A:54 C:34 (34+40) GC*100/54+69+40+34 G:40 T:69 range: 40008 .. 40207 A:54 C:33 (33+41) GC*100/54+69+41+33 G:41 T:69 range: 40009 .. 40208 A:54 C:33 (33+42) GC*100/54+68+42+33 G:42 T:68 range: 40010 .. 40209 A:54 C:32 (32+42) GC*100/54+69+42+32 G:42 T:69 range: 40011 .. 40210 A:54 C:32 (32+41) GC*100/54+70+41+32 G:41 T:70 range: 40012 .. 40211 A:54 C:32 (32+42) GC*100/54+69+42+32 G:42 T:69 range: 40013 .. 40212 A:54 C:33 (33+41) GC*100/54+69+41+33 G:41 T:69 range: 40014 .. 40213 A:54 C:34 (34+41) GC*100/54+68+41+34 G:41 T:68 range: 40015 .. 40214 A:55 C:34 (34+40) GC*100/55+68+40+34 G:40 T:68 range: 40016 .. 40215 A:55 C:35 (35+39) GC*100/55+68+39+35 G:39 T:68 range: 40017 .. 40216 A:54 C:35 (35+39) GC*100/54+69+39+35 G:39 T:69 range: 40018 .. 40217 A:54 C:35 (35+40) GC*100/54+68+40+35 G:40 T:68 range: 40019 .. 40218 A:55 C:35 (35+40) GC*100/55+67+40+35 G:40 T:67 range: 40020 .. 40219 A:55 C:36 (36+40) GC*100/55+66+40+36 G:40 T:66 range: 40021 .. 40220 A:55 C:36 (36+41) GC*100/55+65+41+36 G:41 T:65 range: 40022 .. 40221 A:55 C:36 (36+42) GC*100/55+64+42+36 G:42 T:64 range: 40023 .. 40222 A:55 C:37 (37+42) GC*100/55+63+42+37 G:42 T:63 range: 40024 .. 40223 A:56 C:37 (37+42) GC*100/56+62+42+37 G:42 T:62 range: 40025 .. 40224 A:57 C:37 (37+42) GC*100/57+61+42+37 G:42 T:61 range: 40026 .. 40225 A:56 C:37 (37+43) GC*100/56+61+43+37 G:43 T:61 range: 40027 .. 40226 A:55 C:37 (37+44) GC*100/55+61+44+37 G:44 T:61 range: 40028 .. 40227 A:54 C:38 (38+44) GC*100/54+61+44+38 G:44 T:61 range: 40029 .. 40228 A:55 C:38 (38+44) GC*100/55+60+44+38 G:44 T:60 range: 40030 .. 40229 A:55 C:38 (38+44) GC*100/55+60+44+38 G:44 T:60 range: 40031 .. 40230 A:54 C:39 (39+44) GC*100/54+60+44+39 G:44 T:60 range: 40032 .. 40231 A:53 C:39 (39+45) GC*100/53+60+45+39 G:45 T:60 range: 40033 .. 40232 A:53 C:39 (39+44) GC*100/53+61+44+39 G:44 T:61 range: 40034 .. 40233 A:53 C:39 (39+44) GC*100/53+61+44+39 G:44 T:61 range: 40035 .. 40234 A:53 C:38 (38+45) GC*100/53+61+45+38 G:45 T:61 range: 40036 .. 40235 A:53 C:37 (37+45) GC*100/53+62+45+37 G:45 T:62 range: 40037 .. 40236 A:53 C:37 (37+45) GC*100/53+62+45+37 G:45 T:62 range: 40038 .. 40237 A:53 C:37 (37+45) GC*100/53+62+45+37 G:45 T:62 range: 40039 .. 40238 A:53 C:37 (37+45) GC*100/53+62+45+37 G:45 T:62 range: 40040 .. 40239 A:53 C:36 (36+45) GC*100/53+63+45+36 G:45 T:63 range: 40041 .. 40240 A:53 C:36 (36+45) GC*100/53+63+45+36 G:45 T:63 range: 40042 .. 40241 A:53 C:35 (35+46) GC*100/53+63+46+35 G:46 T:63 range: 40043 .. 40242 A:54 C:35 (35+45) GC*100/54+63+45+35 G:45 T:63 range: 40044 .. 40243 A:54 C:36 (36+45) GC*100/54+63+45+36 G:45 T:63 range: 40045 .. 40244 A:53 C:36 (36+45) GC*100/53+64+45+36 G:45 T:64 range: 40046 .. 40245 A:53 C:37 (37+44) GC*100/53+64+44+37 G:44 T:64 range: 40047 .. 40246 A:53 C:37 (37+44) GC*100/53+64+44+37 G:44 T:64 range: 40048 .. 40247 A:52 C:37 (37+45) GC*100/52+64+45+37 G:45 T:64 range: 40049 .. 40248 A:52 C:36 (36+46) GC*100/52+64+46+36 G:46 T:64 range: 40050 .. 40249 A:51 C:37 (37+46) GC*100/51+64+46+37 G:46 T:64 range: 40051 .. 40250 A:51 C:37 (37+45) GC*100/51+65+45+37 G:45 T:65 range: 40052 .. 40251 A:50 C:38 (38+45) GC*100/50+65+45+38 G:45 T:65 range: 40053 .. 40252 A:49 C:38 (38+45) GC*100/49+66+45+38 G:45 T:66 range: 40054 .. 40253 A:48 C:39 (39+45) GC*100/48+66+45+39 G:45 T:66 range: 40055 .. 40254 A:48 C:38 (38+46) GC*100/48+66+46+38 G:46 T:66 range: 40056 .. 40255 A:47 C:38 (38+46) GC*100/47+67+46+38 G:46 T:67 range: 40057 .. 40256 A:47 C:38 (38+46) GC*100/47+66+46+38 G:46 T:66 range: 40058 .. 40257 A:47 C:39 (39+46) GC*100/47+65+46+39 G:46 T:65 range: 40059 .. 40258 A:47 C:39 (39+46) GC*100/47+65+46+39 G:46 T:65 range: 40060 .. 40259 A:47 C:39 (39+45) GC*100/47+66+45+39 G:45 T:66 range: 40061 .. 40260 A:47 C:38 (38+45) GC*100/47+67+45+38 G:45 T:67 range: 40062 .. 40261 A:47 C:38 (38+46) GC*100/47+66+46+38 G:46 T:66 range: 40063 .. 40262 A:48 C:38 (38+46) GC*100/48+65+46+38 G:46 T:65 range: 40064 .. 40263 A:48 C:38 (38+47) GC*100/48+64+47+38 G:47 T:64 range: 40065 .. 40264 A:48 C:38 (38+48) GC*100/48+63+48+38 G:48 T:63 range: 40066 .. 40265 A:47 C:39 (39+48) GC*100/47+63+48+39 G:48 T:63 range: 40067 .. 40266 A:48 C:38 (38+48) GC*100/48+63+48+38 G:48 T:63 range: 40068 .. 40267 A:49 C:38 (38+48) GC*100/49+62+48+38 G:48 T:62 range: 40069 .. 40268 A:48 C:39 (39+48) GC*100/48+62+48+39 G:48 T:62 range: 40070 .. 40269 A:49 C:38 (38+48) GC*100/49+62+48+38 G:48 T:62 range: 40071 .. 40270 A:48 C:38 (38+49) GC*100/48+62+49+38 G:49 T:62 range: 40072 .. 40271 A:49 C:37 (37+49) GC*100/49+62+49+37 G:49 T:62 range: 40073 .. 40272 A:48 C:38 (38+49) GC*100/48+62+49+38 G:4

In reply to Re^12: how to access elements in perl by grewal7634
in thread how to access elements in perl by grewal7634

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post; it's "PerlMonks-approved HTML":



  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.
  • Log In?
    Username:
    Password:

    What's my password?
    Create A New User
    Chatterbox?
    and the web crawler heard nothing...

    How do I use this? | Other CB clients
    Other Users?
    Others examining the Monastery: (7)
    As of 2015-07-08 00:27 GMT
    Sections?
    Information?
    Find Nodes?
    Leftovers?
      Voting Booth?

      The top three priorities of my open tasks are (in descending order of likelihood to be worked on) ...









      Results (93 votes), past polls