Beefy Boxes and Bandwidth Generously Provided by pair Networks
The stupid question is the question not asked
 
PerlMonks  

Comment on

( #3333=superdoc: print w/ replies, xml ) Need Help??

Hey i have done following modifications in above code, but i need some more help from you to modify it a little bit.

#! perl -slw use strict; my $dna = do{ local $/; <DATA> }; $dna =~ tr[\n][]d; my$len = length $dna; my %counts; ++$counts{ substr $dna, $_, 1 } for 0 ..199; # output.txt file will be created in which all of your results will be + stored. You can change the name of file as your wish. open(PAGE,">output.txt") || die"Can't open Outfile\n"; for my $offset ( 0 .. length( $dna )-200 ) { if ((($counts{'G'}+$counts{'C'})/(200)*100) > 40) { printf PAGE "range: %d .. %d A:%d C:%d G:%d T:%d G+C:%d GC%%:%d E +:%d R:%.1f\n", $offset, $offset+199, @counts{ qw[ A C G T ] }, $coun +ts{'G'}+$counts{'C'}, ($counts{'G'}+$counts{'C'})/(200)*100, ($len)*5 +/100, (($counts{'G'}+$counts{'C'})/(200)*100)/(($len)*5/100)*100; } --$counts{ substr $dna, $offset, 1 }; ++$counts{ substr $dna, $offset+200, 1 }; } print "The length of entire DNA sequence is = $len\n"; __DATA__ GATCTAAATGCTAGCTAGCTAGCTAGCTGGAATCCTCAATAGCTCAATCGATTCAATGCGCGCGTATAAG GGTAAGCGGTCCGCTACGATCCATCACATTCCACAATTAAAATTACCAAAATCGCATTCAAGGTCTCACA TAAAGAGTGCAGCTGCATCGATTGTAAATGCATAGATACATCATTAAATCTACAACACAGTTGACAAGAA CGTCAAAACCGTATTGTTTCAAAACTAAGGTCAAAAAAACCAAGCAGCATTTTGTTTTTGAAAATATACC CAAATATGTGCTAGCTACGACAAATAGCAATGTATTTATCCATAGCGATCGCGGACCTAACTTTCGCAAA AAATGCCAAGCCTAACCCAGACAAGACTCTCGCAATGAAATCGGAAAACAATAGCACTATGATGTATATT TCGTTCAGTTTTTGGTGAAAGAGCTCGAAGGTTTCATTAACGATAATCGCAAGGGCTAGCGAGCCTTTGG AAGCTGTCCTGTGACACGTTGACAATTCAATATATTACACTACATATTTTTACATATTATTTATATAATA TATAAGCATCGATGCAGCGAATCGTTCTTATTTCAATATGTACGAGTGTTTTGCGATACAAAATATCCCA ACGAGCACATTTCAGGGCATTTTATGAGACCGATCTGACGAGTCTGACGCTCGCAAAAGGCTTTTATGTT AAATGCAAATAAAAGATCGAGCAGTCTGACGTATACATGGAATTGCCTTCATTGCAAGAAAACAAATTTT CTCTAAACTGTCCTAACTGGCTGACTGATTGGTTAATAAACGCACAGAGTTAGAAAGCTGACACTTGAAC TTTAAGCAGCAGCGAGCAGCGTAATTTATATGATGAGGTCATGGAAATTTTACCGACATGTATGGTAAAT ACAAATTGTTTGGTAGTTCCGGTGCGCCTAAGACGCGTAGATTATCCGATCGGCTCTAAACTTATTTTCG +
output: range: 0 .. 199 A:69 C:47 G:35 T:49 G+C:82 GC%:41 E:49 R:83.7 range: 1 .. 200 A:69 C:47 G:34 T:50 G+C:81 GC%:40 E:49 R:82.7 range: 2 .. 201 A:68 C:47 G:34 T:51 G+C:81 GC%:40 E:49 R:82.7 range: 3 .. 202 A:68 C:47 G:35 T:50 G+C:82 GC%:41 E:49 R:83.7 range: 4 .. 203 A:69 C:46 G:35 T:50 G+C:81 GC%:40 E:49 R:82.7 range: 5 .. 204 A:69 C:47 G:35 T:49 G+C:82 GC%:41 E:49 R:83.7 range: 6 .. 205 A:69 C:47 G:35 T:49 G+C:82 GC%:41 E:49 R:83.7 range: 7 .. 206 A:69 C:47 G:35 T:49 G+C:82 GC%:41 E:49 R:83.7 range: 8 .. 207 A:68 C:47 G:36 T:49 G+C:83 GC%:41 E:49 R:84.7 range: 9 .. 208 A:69 C:47 G:36 T:48 G+C:83 GC%:41 E:49 R:84.7 range: 10 .. 209 A:70 C:47 G:35 T:48 G+C:82 GC%:41 E:49 R:83.7 range: 11 .. 210 A:70 C:47 G:35 T:48 G+C:82 GC%:41 E:49 R:83.7 range: 12 .. 211 A:70 C:47 G:36 T:47 G+C:83 GC%:41 E:49 R:84.7 range: 13 .. 212 A:69 C:47 G:36 T:48 G+C:83 GC%:41 E:49 R:84.7 range: 14 .. 213 A:69 C:48 G:35 T:48 G+C:83 GC%:41 E:49 R:84.7 range: 15 .. 214 A:70 C:47 G:35 T:48 G+C:82 GC%:41 E:49 R:83.7 range: 16 .. 215 A:71 C:47 G:35 T:47 G+C:82 GC%:41 E:49 R:83.7 range: 17 .. 216 A:71 C:47 G:35 T:47 G+C:82 GC%:41 E:49 R:83.7 range: 18 .. 217 A:72 C:47 G:34 T:47 G+C:81 GC%:40 E:49 R:82.7 range: 19 .. 218 A:72 C:47 G:34 T:47 G+C:81 GC%:40 E:49 R:82.7 range: 20 .. 219 A:72 C:48 G:34 T:46 G+C:82 GC%:41 E:49 R:83.7 range: 21 .. 220 A:71 C:48 G:35 T:46 G+C:83 GC%:41 E:49 R:84.7 range: 22 .. 221 A:71 C:48 G:34 T:47 G+C:82 GC%:41 E:49 R:83.7 range: 23 .. 222 A:72 C:47 G:34 T:47 G+C:81 GC%:40 E:49 R:82.7 range: 24 .. 223 A:72 C:47 G:34 T:47 G+C:81 GC%:40 E:49 R:82.7 range: 25 .. 224 A:71 C:47 G:34 T:48 G+C:81 GC%:40 E:49 R:82.7 range: 26 .. 225 A:71 C:47 G:34 T:48 G+C:81 GC%:40 E:49 R:82.7 range: 276 .. 475 A:69 C:43 G:38 T:50 G+C:81 GC%:40 E:49 R:82.7 range: 277 .. 476 A:69 C:43 G:38 T:50 G+C:81 GC%:40 E:49 R:82.7 range: 278 .. 477 A:69 C:43 G:38 T:50 G+C:81 GC%:40 E:49 R:82.7 range: 279 .. 478 A:69 C:42 G:39 T:50 G+C:81 GC%:40 E:49 R:82.7 range: 280 .. 479 A:69 C:42 G:39 T:50 G+C:81 GC%:40 E:49 R:82.7 range: 281 .. 480 A:69 C:41 G:40 T:50 G+C:81 GC%:40 E:49 R:82.7 range: 282 .. 481 A:69 C:41 G:40 T:50 G+C:81 GC%:40 E:49 R:82.7 range: 283 .. 482 A:68 C:41 G:41 T:50 G+C:82 GC%:41 E:49 R:83.7 range: 284 .. 483 A:67 C:42 G:41 T:50 G+C:83 GC%:41 E:49 R:84.7 range: 285 .. 484 A:67 C:43 G:41 T:49 G+C:84 GC%:42 E:49 R:85.7 range: 286 .. 485 A:66 C:43 G:41 T:50 G+C:84 GC%:42 E:49 R:85.7 range: 287 .. 486 A:66 C:43 G:41 T:50 G+C:84 GC%:42 E:49 R:85.7 range: 288 .. 487 A:66 C:43 G:40 T:51 G+C:83 GC%:41 E:49 R:84.7 range: 289 .. 488 A:66 C:43 G:41 T:50 G+C:84 GC%:42 E:49 R:85.7 range: 290 .. 489 A:66 C:43 G:41 T:50 G+C:84 GC%:42 E:49 R:85.7 range: 291 .. 490 A:67 C:42 G:41 T:50 G+C:83 GC%:41 E:49 R:84.7 range: 292 .. 491 A:68 C:42 G:41 T:49 G+C:83 GC%:41 E:49 R:84.7 range: 293 .. 492 A:67 C:42 G:42 T:49 G+C:84 GC%:42 E:49 R:85.7 range: 294 .. 493 A:67 C:43 G:41 T:49 G+C:84 GC%:42 E:49 R:85.7 range: 295 .. 494 A:67 C:42 G:41 T:50 G+C:83 GC%:41 E:49 R:84.7 range: 296 .. 495 A:67 C:42 G:42 T:49 G+C:84 GC%:42 E:49 R:85.7 range: 297 .. 496 A:66 C:42 G:42 T:50 G+C:84 GC%:42 E:49 R:85.7 range: 298 .. 497 A:66 C:42 G:42 T:50 G+C:84 GC%:42 E:49 R:85.7 range: 299 .. 498 A:66 C:43 G:41 T:50 G+C:84 GC%:42 E:49 R:85.7 range: 300 .. 499 A:65 C:43 G:41 T:51 G+C:84 GC%:42 E:49 R:85.7 range: 301 .. 500 A:65 C:42 G:42 T:51 G+C:84 GC%:42 E:49 R:85.7 range: 302 .. 501 A:64 C:42 G:42 T:52 G+C:84 GC%:42 E:49 R:85.7 range: 303 .. 502 A:63 C:42 G:43 T:52 G+C:85 GC%:42 E:49 R:86.7 range: 304 .. 503 A:63 C:42 G:43 T:52 G+C:85 GC%:42 E:49 R:86.7 range: 305 .. 504 A:63 C:43 G:43 T:51 G+C:86 GC%:43 E:49 R:87.8 range: 306 .. 505 A:63 C:43 G:43 T:51 G+C:86 GC%:43 E:49 R:87.8 range: 307 .. 506 A:63 C:44 G:42 T:51 G+C:86 GC%:43 E:49 R:87.8 range: 308 .. 507 A:63 C:43 G:43 T:51 G+C:86 GC%:43 E:49 R:87.8 range: 309 .. 508 A:62 C:43 G:43 T:52 G+C:86 GC%:43 E:49 R:87.8 range: 310 .. 509 A:61 C:43 G:43 T:53 G+C:86 GC%:43 E:49 R:87.8 range: 311 .. 510 A:61 C:43 G:44 T:52 G+C:87 GC%:43 E:49 R:88.8 range: 312 .. 511 A:62 C:43 G:43 T:52 G+C:86 GC%:43 E:49 R:87.8 range: 313 .. 512 A:62 C:44 G:43 T:51 G+C:87 GC%:43 E:49 R:88.8 range: 314 .. 513 A:62 C:44 G:43 T:51 G+C:87 GC%:43 E:49 R:88.8 range: 315 .. 514 A:63 C:44 G:43 T:50 G+C:87 GC%:43 E:49 R:88.8 range: 316 .. 515 A:63 C:44 G:43 T:50 G+C:87 GC%:43 E:49 R:88.8 range: 317 .. 516 A:63 C:44 G:43 T:50 G+C:87 GC%:43 E:49 R:88.8 range: 318 .. 517 A:62 C:45 G:43 T:50 G+C:88 GC%:44 E:49 R:89.8 range: 319 .. 518 A:63 C:45 G:43 T:49 G+C:88 GC%:44 E:49 R:89.8 range: 320 .. 519 A:64 C:44 G:43 T:49 G+C:87 GC%:43 E:49 R:88.8 range: 321 .. 520 A:64 C:43 G:43 T:50 G+C:86 GC%:43 E:49 R:87.8 range: 322 .. 521 A:64 C:43 G:43 T:50 G+C:86 GC%:43 E:49 R:87.8 range: 323 .. 522 A:64 C:43 G:43 T:50 G+C:86 GC%:43 E:49 R:87.8 range: 324 .. 523 A:64 C:43 G:43 T:50 G+C:86 GC%:43 E:49 R:87.8 range: 325 .. 524 A:64 C:43 G:42 T:51 G+C:85 GC%:42 E:49 R:86.7 range: 326 .. 525 A:64 C:42 G:42 T:52 G+C:84 GC%:42 E:49 R:85.7 range: 327 .. 526 A:65 C:42 G:41 T:52 G+C:83 GC%:41 E:49 R:84.7 range: 328 .. 527 A:64 C:43 G:41 T:52 G+C:84 GC%:42 E:49 R:85.7 range: 329 .. 528 A:65 C:43 G:41 T:51 G+C:84 GC%:42 E:49 R:85.7 range: 330 .. 529 A:65 C:43 G:41 T:51 G+C:84 GC%:42 E:49 R:85.7 range: 331 .. 530 A:65 C:43 G:40 T:52 G+C:83 GC%:41 E:49 R:84.7 range: 332 .. 531 A:66 C:42 G:40 T:52 G+C:82 GC%:41 E:49 R:83.7 range: 333 .. 532 A:66 C:43 G:39 T:52 G+C:82 GC%:41 E:49 R:83.7 range: 334 .. 533 A:67 C:43 G:38 T:52 G+C:81 GC%:40 E:49 R:82.7 range: 335 .. 534 A:66 C:43 G:38 T:53 G+C:81 GC%:40 E:49 R:82.7 range: 602 .. 801 A:63 C:40 G:41 T:56 G+C:81 GC%:40 E:49 R:82.7 range: 654 .. 853 A:67 C:39 G:42 T:52 G+C:81 GC%:40 E:49 R:82.7 range: 655 .. 854 A:68 C:39 G:42 T:51 G+C:81 GC%:40 E:49 R:82.7 range: 656 .. 855 A:68 C:39 G:42 T:51 G+C:81 GC%:40 E:49 R:82.7 range: 657 .. 856 A:67 C:40 G:42 T:51 G+C:82 GC%:41 E:49 R:83.7 range: 658 .. 857 A:68 C:40 G:41 T:51 G+C:81 GC%:40 E:49 R:82.7 range: 659 .. 858 A:67 C:40 G:42 T:51 G+C:82 GC%:41 E:49 R:83.7 range: 660 .. 859 A:67 C:40 G:42 T:51 G+C:82 GC%:41 E:49 R:83.7 range: 661 .. 860 A:67 C:39 G:43 T:51 G+C:82 GC%:41 E:49 R:83.7 range: 662 .. 861 A:67 C:39 G:42 T:52 G+C:81 GC%:40 E:49 R:82.7 range: 663 .. 862 A:67 C:39 G:42 T:52 G+C:81 GC%:40 E:49 R:82.7 range: 664 .. 863 A:68 C:39 G:42 T:51 G+C:81 GC%:40 E:49 R:82.7 range: 762 .. 961 A:61 C:36 G:45 T:58 G+C:81 GC%:40 E:49 R:82.7 range: 763 .. 962 A:61 C:35 G:46 T:58 G+C:81 GC%:40 E:49 R:82.7 range: 764 .. 963 A:60 C:36 G:46 T:58 G+C:82 GC%:41 E:49 R:83.7 range: 765 .. 964 A:59 C:36 G:46 T:59 G+C:82 GC%:41 E:49 R:83.7 range: 766 .. 965 A:58 C:37 G:46 T:59 G+C:83 GC%:41 E:49 R:84.7 range: 767 .. 966 A:58 C:37 G:46 T:59 G+C:83 GC%:41 E:49 R:84.7 range: 768 .. 967 A:59 C:37 G:46 T:58 G+C:83 GC%:41 E:49 R:84.7 range: 769 .. 968 A:60 C:37 G:46 T:57 G+C:83 GC%:41 E:49 R:84.7 range: 770 .. 969 A:61 C:37 G:46 T:56 G+C:83 GC%:41 E:49 R:84.7 range: 771 .. 970 A:61 C:37 G:46 T:56 G+C:83 GC%:41 E:49 R:84.7 range: 772 .. 971 A:61 C:37 G:46 T:56 G+C:83 GC%:41 E:49 R:84.7 range: 773 .. 972 A:61 C:36 G:46 T:57 G+C:82 GC%:41 E:49 R:83.7 range: 774 .. 973 A:62 C:36 G:46 T:56 G+C:82 GC%:41 E:49 R:83.7 range: 775 .. 974 A:61 C:36 G:46 T:57 G+C:82 GC%:41 E:49 R:83.7 range: 776 .. 975 A:60 C:36 G:46 T:58 G+C:82 GC%:41 E:49 R:83.7 range: 777 .. 976 A:59 C:36 G:46 T:59 G+C:82 GC%:41 E:49 R:83.7 range: 778 .. 977 A:59 C:35 G:46 T:60 G+C:81 GC%:40 E:49 R:82.7 range: 779 .. 978 A:59 C:36 G:46 T:59 G+C:82 GC%:41 E:49 R:83.7 range: 780 .. 979 A:59 C:36 G:46 T:59 G+C:82 GC%:41 E:49 R:83.7

This code prints only those regions that have GC% more than 40%. i want to count GC only when there is G and C present together as GC or as CG, and not when G and C present randomly as CAGTGATC. After this i have to calculate GC%. Secondly i have to take my input from file, not to copy my input data in the script. Please help me to solve this.


In reply to Re^4: how to access elements in perl by grewal7634
in thread how to access elements in perl by grewal7634

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post; it's "PerlMonks-approved HTML":



  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.
  • Log In?
    Username:
    Password:

    What's my password?
    Create A New User
    Chatterbox?
    and the web crawler heard nothing...

    How do I use this? | Other CB clients
    Other Users?
    Others avoiding work at the Monastery: (17)
    As of 2015-07-30 15:29 GMT
    Sections?
    Information?
    Find Nodes?
    Leftovers?
      Voting Booth?

      The top three priorities of my open tasks are (in descending order of likelihood to be worked on) ...









      Results (272 votes), past polls