Beefy Boxes and Bandwidth Generously Provided by pair Networks
Your skill will accomplish
what the force of many cannot
 
PerlMonks  

comment on

( [id://3333]=superdoc: print w/replies, xml ) Need Help??
Nifty!

perl dna TGAATCTTTGACTCGA

Hope I transcribed that correctly. I just hacked the following out of your code. Ugly, but does the job

#!/usr/bin/perl # Run as dnareader.pl TCCCTCATTGAATCCAAACC # You'll get a ++ from me if you can make it say "perl" # instead. for my $g1 ( 'A', 'C', 'T', 'G' ) { for my $g2 ( 'A', 'C', 'T', 'G' ) { for my $g3 ( 'A', 'C', 'T', 'G' ) { for my $g4 ( 'A', 'C', 'T', 'G' ) { print( "$g1$g2$g3$g4 - " ); letter( "$g1$g2$g3$g4" ); print "\n"; }}}} sub letter { $"='ATCG'; foreach (split '', shift) { $;++;$,=$,<<2|index $",$_; next if $;&3;$,=print chr $,;$,--; } }

From there it's a simple matter of working backwards...

--
g r i n d e r
TACCTGTTTGAGTGTAACAATCATTCGCTCGGTGTATCCATCTTTGACACAATCACTCGGTCTCTCCA

In reply to Re: DNA that is a JAPH by grinder
in thread DNA that is a JAPH by theorbtwo

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post; it's "PerlMonks-approved HTML":



  • Are you posting in the right place? Check out Where do I post X? to know for sure.
  • Posts may use any of the Perl Monks Approved HTML tags. Currently these include the following:
    <code> <a> <b> <big> <blockquote> <br /> <dd> <dl> <dt> <em> <font> <h1> <h2> <h3> <h4> <h5> <h6> <hr /> <i> <li> <nbsp> <ol> <p> <small> <strike> <strong> <sub> <sup> <table> <td> <th> <tr> <tt> <u> <ul>
  • Snippets of code should be wrapped in <code> tags not <pre> tags. In fact, <pre> tags should generally be avoided. If they must be used, extreme care should be taken to ensure that their contents do not have long lines (<70 chars), in order to prevent horizontal scrolling (and possible janitor intervention).
  • Want more info? How to link or How to display code and escape characters are good places to start.
Log In?
Username:
Password:

What's my password?
Create A New User
Domain Nodelet?
Chatterbox?
and the web crawler heard nothing...

How do I use this?Last hourOther CB clients
Other Users?
Others exploiting the Monastery: (6)
As of 2024-04-20 00:48 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    No recent polls found