Beefy Boxes and Bandwidth Generously Provided by pair Networks
Do you know where your variables are?
 
PerlMonks  

comment on

( [id://3333]=superdoc: print w/replies, xml ) Need Help??
Have a look at Regex with variables?. From what I understood this might be what you need.
Cheers, CombatSquirrel.
Update: Or maybe in your case, the following might help as well:
#!perl use strict; use warnings; my ($curr, $probe, $target, $pos, $sense); for (<DATA>) { if (/>probe:(\w+):(\w+):\d+:\d+;\s+Interrogation_Position=(\d+);\s+ +(\w+);/) { ($probe, $target, $pos, $sense) = ($1, $2, $3, $4); if ($curr and $curr ne $target) { if ($curr) { ### do processing for mismatch here } $curr = $target; } else { $curr = $target if (!$curr); ### do processing for target here } } else { ### do processing for probe sequence here } } __DATA__ >probe:MOE430A:1415670_at:549:177; Interrogation_Position=2436; Antise +nse; GGCTGATCACATCCAAAAAGTCATG >probe:MOE430A:1415670_at:549:177; Interrogation_Position=2513; Antise +nse; GAGGAAACGTTCACCCTGTCTACTA >probe:MOE430A:1415670_at:467:433; Interrogation_Position=2521; Antise +nse; GTTCACCCTGTCTACTATCAAGACA >probe:MOE430A:1415670_at:254:643; Interrogation_Position=2533; Antise +nse; TACTATCAAGACACTCGAAGAGGCT >probe:MOE430A:1415670_at:54:269; Interrogation_Position=2556; Antisen +se; CTGTGGGCAATATTGTGAAGTTCCT >probe:MOE430A:1415670_at:405:339; Interrogation_Position=2583; Antise +nse; GAATGCATCCTTGTGAGAGGTCAGA >probe:MOE430A:1415670_at:60:395; Interrogation_Position=2597; Antisen +se; GAGAGGTCAGACAAAGTGCCAGAAA >probe:MOE430A:1415670_at:284:165; Interrogation_Position=2619; Antise +nse; AAAACAAGAACACCCACACGCTGCT >probe:MOE430A:1415670_at:622:145; Interrogation_Position=2634; Antise +nse; ACACGCTGCTGCTAGCTGGAGTATT >probe:MOE430A:1415670_at:291:661; Interrogation_Position=2804; Antise +nse; TATCTTGTCCAACACTACGTCGAAG >probe:MOE430A:1415670_at:146:701; Interrogation_Position=2956; Antise +nse; TTGTCACCATGCCTGCAAGGAGAGA >probe:MOE430A:1415671_at:116:525; Interrogation_Position=1156; Antise +nse; GGAACAGGAATGTCGCAACATCGTA >probe:MOE430A:1415671_at:655:137; Interrogation_Position=1173; Antise +nse; ACATCGTATGGATTGCTGAGTGCAT >probe:MOE430A:1415671_at:398:139; Interrogation_Position=1232; Antise +nse;

In reply to Re: Little pattern problem... by CombatSquirrel
in thread Little pattern problem... by bioinformatics

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post; it's "PerlMonks-approved HTML":



  • Are you posting in the right place? Check out Where do I post X? to know for sure.
  • Posts may use any of the Perl Monks Approved HTML tags. Currently these include the following:
    <code> <a> <b> <big> <blockquote> <br /> <dd> <dl> <dt> <em> <font> <h1> <h2> <h3> <h4> <h5> <h6> <hr /> <i> <li> <nbsp> <ol> <p> <small> <strike> <strong> <sub> <sup> <table> <td> <th> <tr> <tt> <u> <ul>
  • Snippets of code should be wrapped in <code> tags not <pre> tags. In fact, <pre> tags should generally be avoided. If they must be used, extreme care should be taken to ensure that their contents do not have long lines (<70 chars), in order to prevent horizontal scrolling (and possible janitor intervention).
  • Want more info? How to link or How to display code and escape characters are good places to start.
Log In?
Username:
Password:

What's my password?
Create A New User
Domain Nodelet?
Chatterbox?
and the web crawler heard nothing...

How do I use this?Last hourOther CB clients
Other Users?
Others studying the Monastery: (6)
As of 2024-04-23 21:16 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    No recent polls found