Beefy Boxes and Bandwidth Generously Provided by pair Networks Bob
Your skill will accomplish
what the force of many cannot
 
PerlMonks  

Comment on

( #3333=superdoc: print w/ replies, xml ) Need Help??
Hello

I cannot get the following code to capture what is in a lookahead (when the lookahead is within capturing parens. .

What I'm trying to achieve is to capture substrings of length 'x' beginning with the first character in the fasta sequence (and the lookahead portion) progressing from the first character, the second, and so on, until the substrings run up against the end of the characters.

Thanks in advance for any help.

Chris

#!/usr/bin/perl use strict; use warnings; my $str = do {local $/; <DATA>}; $str =~ s/\s+//g; my $len = length $str; while (--$len > 780) { while ($str =~ /(.(?=.{$len}))/g) { print pos, "$1\n"; } pos = 0; } __DATA__ CAATATGCGAGGGACCTACATGTTGAGCATGACAATGAATTCTATTGAAAAAAAGAGTTG GAAGTATATACGAATATAAATAATGTGAAACAAAAGAAGAAAAGTGAATAAAAGGCACTT AAGACGCTATCCAATTGTGTATGAGAAGTGCAAACTCAATTTTTTTGCAAAAGACTTTTC TCAAACCTTTAATTGATGCGTTCCGTTCATACATCAACCGCGTCCCATACGTTTCGAAGA AAATTGCCTATATGTGTTATTTACATACTAGAGATATTTTAATATTGAAACAGTTGTATT TCTATTGTAATTACTATCTAAACGTCTCGTCCCACCGCTGTTGATAAAGCGGTGCCAATA TAATTTATAATCACGCCTGGGTAAATGACTTTTAATTTCTTAAATCATCGAAGTATGCGA AAACAAGAAGTCTTTATTCATAATAAAAAACAAATTCGGTTACTACGACTTTTATATGTC ATTCAATATTTGGTAATAATTTTACAGTATTAACCCTATCCTCATCTGATTCACTCTCTT CTAATTGCATATATTTTCAAATTCGCTTTCAGCGCTGTACAAAACCAGTAAGCAGATCTC GTACGAAGACTCAAATAAGTTGCATTGTTCGTATTCAAGGAAACCGGGGGGCAAAATTTC CAACCATATTTAAGTATGACAATATTTCCAAGTCAAGGATGCATGCTGTTCTTCTCTTCA TTAACTAGCTAACCAATTAGCTGAACGGCTTTGTATTTTACTTAACATATTGTCTATTGC ATAAAAAACCACTATTCAGC

In reply to Capture Lookahead by Anonymous Monk

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post; it's "PerlMonks-approved HTML":



  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • Outside of code tags, you may need to use entities for some characters:
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.
  • Log In?
    Username:
    Password:

    What's my password?
    Create A New User
    Chatterbox?
    and the web crawler heard nothing...

    How do I use this? | Other CB clients
    Other Users?
    Others scrutinizing the Monastery: (5)
    As of 2014-04-18 10:45 GMT
    Sections?
    Information?
    Find Nodes?
    Leftovers?
      Voting Booth?

      April first is:







      Results (466 votes), past polls