in reply to Simple regex question. Grouping with a negative lookahead assertion.

Like this?

[0] Perl> $dna = 'atctcggataatgggataaaaatataggctataaatggcgccccggctaatt +ttt';; [0] Perl> print $1 while $dna =~ m[atg(.+?)(?=taa|tag|tga)]g;; gga gcgccccggc

If so, the difference is the use of the non-greedy match quantifier +?

With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday'
Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
"Science is about questioning the status quo. Questioning authority".
In the absence of evidence, opinion is indistinguishable from prejudice.