http://www.perlmonks.org?node_id=11113588


in reply to Assigning multiple lines into first element of array

Read to the next "\n>" and then fix up the line ends. 

#!/usr/bin/perl

use strict; # https://perlmonks.org/?node_id=11113581
use warnings;

my $filename = 'file.fasta';
open my $handle, '<', $filename or die "$! opening $filename";
my @array = map s/>\z//r =~ s/^(?!>)/>/r, do { local $/ ="\n>"; <$hand
+le> };
use Data::Dumper; print Dumper \@array;

[download]

Or read the whole thing and split with a look-ahead for > 

#!/usr/bin/perl

use strict; # https://perlmonks.org/?node_id=11113581
use warnings;

my $filename = 'file.fasta';
open my $handle, '<', $filename or die "$! opening $filename";
my @array = split /(?=>)/, do { local $/; <$handle> };
use Data::Dumper; print Dumper \@array;

[download]

Replies are listed 'Best First'.
Re^2: Assigning multiple lines into first element of array
by shabird (Sexton) on Mar 01, 2020 at 02:13 UTC

    Thank you so much! it worked like a charm :)

[reply]
Re^2: Assigning multiple lines into first element of array
by shabird (Sexton) on Mar 01, 2020 at 03:09 UTC

    Everything works good but one more thing how can i count number of characters in first element of the array? When it returns first element of array it has many characters e.g: GAGGTGCTGGGGAGCAGCGTGTTTGCTGTGCTTGATTGTGAGCTGCTGGGAAGTTGTGACTTTCATTTTA CCTTTCGAATTCCTGGGTATATCTTGGGGGCTGGAGGACGTGTCTGGTTATTATATAGGTGCACAGCTGG. how come i count these characters?

[reply]

      See length: 

      c:\@Work\Perl\monks>perl -wMstrict -le
"my @ra = ('MANYCHARACTERS');
 printf qq{1st element of array has %d characters \n}, length $ra[0];
"
1st element of array has 14 characters

      [download]

      Give a man a fish:  <%-{-{-{-<

[reply]
[d/l]
[select]

      ... 

      my @counts = map s/.*\n//r =~ tr/A-Z//, @array;
print "counts: @counts\n";

      [download]
[reply]
[d/l]

In Section Seekers of Perl Wisdom