Beefy Boxes and Bandwidth Generously Provided by pair Networks
No such thing as a small change
 
PerlMonks  

Assigning multiple lines into first element of array

by shabird (Sexton)
on Feb 29, 2020 at 18:03 UTC ( #11113581=perlquestion: print w/replies, xml ) Need Help??

Help for this page

Select Code to Download


  1. or download this
    >NM_030643.4 Homo sapiens apolipoprotein L4 (APOL4) 
     GAGGTGCTGGGGAGCAGCGTGTTTGCTGTGCTTGATTGTGAGCTGCTGGGAAGTTGTGACTTTCATTTT
    +A
    ...
     AGTGATCAACTAGTTTTTGTTGTTGTTGTTGTTTGAGACAGAGTCTCACTCTGTCGCCCAGGCTGGAGT
    +G
     CAGTGGCGAGATCTCAGCTCACTGCAACCTCTGCTGCCCAGGTTCAAGGGATTCTCCTGCCTCAGCCTC
    +C
     CAAGTAGCTGGTATTACAGGCACCTGCCACCGCGCCTGGCTAATTTTTTTTTTTTTTTTTTTTTGTATT
    +T
    
  2. or download this
    >NM_030643.4 Homo sapiens apolipoprotein L4 (APOL4) 
     GAGGTGCTGGGGAGCAGCGTGTTTGCTGTGCTTGATTGTGAGCTGCTGGGAAGTTGTGACTTTCATTTT
    +A
     CCTTTCGAATTCCTGGGTATATCTTGGGGGCTGGAGGACGTGTCTGGTTATTATATAGGTGCACAGCTG
    +G
     AGGTGAGATCCACACAGCTCAGACCAGCTGGATCTTGCTCAGTCTCTGTCAGAGGAAGATCCCTTGGAG
    +G
     AGGCCCCGCAGCGACATGGAGGGAGCTGCTTTGCTGAAAATCTTTGTCGTCTGCATCTGGAACCAAAAT
    +C
    
  3. or download this
    my $filename = '/file.fasta';
     
    ...
    
    my @chars = <MY_HANDLE>;
    print "@chars[0]\n";
    

Log In?
Username:
Password:

What's my password?
Create A New User
Domain Nodelet?
Node Status?
node history
Node Type: perlquestion [id://11113581]
Approved by LanX
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others perusing the Monastery: (5)
As of 2021-07-27 10:58 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    No recent polls found

    Notices?