Beefy Boxes and Bandwidth Generously Provided by pair Networks
Pathologically Eclectic Rubbish Lister
 
PerlMonks  

Re: Assigning multiple lines into first element of array

by johngg (Canon)
on Mar 01, 2020 at 00:46 UTC ( #11113590=note: print w/replies, xml ) Need Help??

Help for this page

Select Code to Download


  1. or download this
    use 5.026;
    use warnings;
    ...
        $seqTitle               = $_;
        $accumulator            = q{};
    }
    
  2. or download this
    >AC067940.1 Homo sapiens clone RP11-818E9, LOW-PASS SEQUENCE SAMPLING
    >NM_001198855.1 Homo sapiens cytochrome P450 family 2 subfamily C memb
    +er 8 (CYP2C8)
    ...
                   '>NM_030643.4 Homo sapiens apolipoprotein L4 (APOL4) ' 
    +=> 'GAGGTGCTGGGGAGCAGCGTGTTTGCTGTGCTTGATTGTGAGCTGCTGGGAAGTTGTGACTTTCA
    +TTTTACCTTTCGAATTCCTGGGTATATCTTGGGGGCTGGAGGACGTGTCTGGTTATTATATAGGTGCAC
    +AGCTGGAGGTGAGATCCACACAGCTCAGACCAGCTGGATCTTGCTCAGTCTCTGTCAGAGGAAGATCCC
    +TTGGAGGAGGCCCCGCAGCGACATGGAGGGAGCTGCTTTGCTGAAAATCTTTGTCGTCTGCATCTGGAA
    +CCAAAATC',
                   '>NR_029834.1 Homo sapiens microRNA 200a (MIR200A), mic
    +roRNA' => 'CCGGGCCCCTGTGAGCATCTTACCGGACAGTGCTGGATTTCCCAGCTTGACTCTAACA
    +CTGTCTGGTAACGATGTTCAAAGGTGACCCGC'
                 );
    

Log In?
Username:
Password:

What's my password?
Create A New User
Domain Nodelet?
Node Status?
node history
Node Type: note [id://11113590]
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others studying the Monastery: (4)
As of 2021-10-25 13:44 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?
    My first memorable Perl project was:







    Results (89 votes). Check out past polls.

    Notices?