Re^2: How do you match a stretch of at least N characters

[Anonymous Monk]

Original post deleted. What I posted was completely wrong.

You're supposed to <strike></strike> out the wrong answer not delete

[paisani]

Is this what you were looking for? The longest matching DNA string? You can save the max length found below to get your result.

Answer:

Found match of length (102) at position(506, 0):

AAATTGGTGTATATGAAAGACCTCGACGCTATTTAGAAAGAGAGAGCAATATTTCAAGAATGCATGCGTCAATTTTACGCAGACTATCTTTCTAGGGTTAAT
AAATTGGTGTATATGAAAGACCTCGACGCTATTTAGAAAGAGAGAGCAATATTTCAAGAATGCATGCGTCAATTTTACGCAGACTATCTTTCTAGGGTTAAA

my $i=-1;
while(++$i < length($reference_str)) {
   my $j=-1;
   while(++$j < length($small_str)) {

       my $length = 9;
       my $match=undef;
       while ( $i+$length < length($reference_str) and
               $j+$length < length($small_str) and
               compareSnippet($i, $j, ++$length) ) {
          $match++;
       }
       if ( $match) {
          $length--;
          print "Found match of length ($length) at position($i, $j): 
+\n";
          print substr($reference_str, $i, $length) . "\n";
          print substr($small_str, $j, $length). "\n";
          $i+= $length;
          $j+= $length;
          next;
       }
   }
}

sub compareSnippet {
   my ( $pos_i, $pos_j, $length) = @_;
   my $ref = substr($reference_str, $pos_i, $length); my @ref_arr = sp
+lit('', $ref);
   my $small = substr($small_str, $pos_j, $length); my @small_arr = sp
+lit('', $small);

   return undef if length($ref) < $length or length($small) < $length;

   return equal(\@ref_arr, \@small_arr);

}


sub equal {
    my ($first, $second) = @_;
    my $mismatch=0;
    foreach my $i (0..(@$first-1)) {
      $mismatch++ if $first->[$i] ne $second->[$i];
      return undef if $mismatch > 1;
    }
      # print "Woo! (@$first, @$second)\n" if $mismatch == 0;
    return 1;
}