Beefy Boxes and Bandwidth Generously Provided by pair Networks
more useful options

Re: Using Recursion to Find DNA Sequences

by johngg (Canon)
on Oct 29, 2017 at 15:31 UTC ( #1202285=note: print w/replies, xml ) Need Help??

in reply to Using Recursion to Find DNA Sequences

Please could you confirm that these are the matches that you are hoping for.

AATGGTTTCTCCCATCTCTCCATCGGCATAAAAATACAGAATGATCTAA ^^^------------------------^^^ ^^^-------------------------------------^^^ ^^^------------------------------------------^^^ ^^^---^^^

Those are the ones I can spot using just my eyes but I might be misunderstanding your rules.



Replies are listed 'Best First'.
Re^2: Using Recursion to Find DNA Sequences
by clueless_perl (Initiate) on Oct 29, 2017 at 18:43 UTC

      To get the shortest-to-longest length ordering from the approach I outlined here, just use a  ? "lazy" modifier on the quantifier of the  \w* "padding" sub-pattern making it  \w*? :
          qr{ ATG \w*? (?: TAG | TAA | TGA) }xms;

      Give a man a fish:  <%-{-{-{-<

Log In?

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://1202285]
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others having an uproarious good time at the Monastery: (4)
As of 2019-02-16 11:05 GMT
Find Nodes?
    Voting Booth?
    I use postfix dereferencing ...

    Results (95 votes). Check out past polls.
