Beefy Boxes and Bandwidth Generously Provided by pair Networks
go ahead... be a heretic
 
PerlMonks  

Re: Using Recursion to Find DNA Sequences

by johngg (Abbot)
on Oct 29, 2017 at 15:31 UTC ( #1202285=note: print w/replies, xml ) Need Help??


in reply to Using Recursion to Find DNA Sequences

Please could you confirm that these are the matches that you are hoping for.

AATGGTTTCTCCCATCTCTCCATCGGCATAAAAATACAGAATGATCTAA ^^^------------------------^^^ ^^^-------------------------------------^^^ ^^^------------------------------------------^^^ ^^^---^^^

Those are the ones I can spot using just my eyes but I might be misunderstanding your rules.

Cheers,

JohnGG

Replies are listed 'Best First'.
Re^2: Using Recursion to Find DNA Sequences
by clueless_perl (Initiate) on Oct 29, 2017 at 18:43 UTC
    Thanks everyone! The matches that I am looking for (which JohnGG correctly highlighted) are: ATGGTTTCTCCCATCTCTCCATCGGCATAA ATGGTTTCTCCCATCTCTCCATCGGCATAAAAATACAGAATGA ATGGTTTCTCCCATCTCTCCATCGGCATAAAAATACAGAATGATCTAA ATGATCTAA

      To get the shortest-to-longest length ordering from the approach I outlined here, just use a  ? "lazy" modifier on the quantifier of the  \w* "padding" sub-pattern making it  \w*? :
          qr{ ATG \w*? (?: TAG | TAA | TGA) }xms;


      Give a man a fish:  <%-{-{-{-<

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://1202285]
help
Chatterbox?
and all is quiet...

How do I use this? | Other CB clients
Other Users?
Others taking refuge in the Monastery: (3)
As of 2018-07-18 09:05 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?
    It has been suggested to rename Perl 6 in order to boost its marketing potential. Which name would you prefer?















    Results (388 votes). Check out past polls.

    Notices?