String into Array

[cdherold]

Hello friends,

It's simple enough to put a string into an array using split() ... but that's if you've got something to split on ... like say a space or a "," ... or even a word boundry. But what do you do when all you've got is a string of characters ... say a long DNA sequence something like ... AGTCGTCGATGCTGATGCTAGCCCC ... ? i was looking for a "letter boundry" type of anchor (something similar to word boundry - \b), but couldn't find one. Did i miss something? If not, how do i split this string into an array (one letter for each element in the array)?

thanks,

chris

[BeernuT]

if you just want 1 letter per element then simply do


$string = 'hello';
@array = split(//, $string);


hope this helps

-bn

-----BEGIN PERL GEEK CODE BLOCK----- Version: 0.01 P+>+++( )$c->++P6 R++>+M >+$O >++MA+>++E >+PU >++BD >+++C+$D++$S+++>++++$X!WP+> ( )MO!PP++++n+>++CO-->+++PO-o >++G >+++A >+++OL!OLC+>++OLR+>++Ee!Ev!Eon+uL+++>*$ uB+$uS+$uH+$uo+$w-->---m! ------END PERL GEEK CODE BLOCK------

[little]

@results = split (/\s*/,$string);

matches zero or more times
Have a nice day
All decision is left to your taste

[chromatic]

Split on ''.

[rob_au]

I'm not quite sure what you are after but you will find that split //, $string will split the string making each character a separate element of the returned list.

 

perl -e 's&&[e-mail]&&&split/[@.]/&&s&.com.&_&&&print'

[blakem]

You can use global matching /./g to process N chars at-a-time.

#!/usr/bin/perl -wT
use strict;

my $string = 'AGTCGTCGATGCTGATGCTAGCCCC';
print "one at-a-time: $_\n" for $string =~ /./g;
print "two at-a-time: $_\n" for $string =~ /.{1,2}/g;
print "six at-a-time: $_\n" for $string =~ /.{1,6}/g;

__END__

=head1 OUTPUT
one at-a-time: A
one at-a-time: G
one at-a-time: T
one at-a-time: C
one at-a-time: G
one at-a-time: T
one at-a-time: C
one at-a-time: G
one at-a-time: A
one at-a-time: T
one at-a-time: G
one at-a-time: C
one at-a-time: T
one at-a-time: G
one at-a-time: A
one at-a-time: T
one at-a-time: G
one at-a-time: C
one at-a-time: T
one at-a-time: A
one at-a-time: G
one at-a-time: C
one at-a-time: C
one at-a-time: C
one at-a-time: C
two at-a-time: AG
two at-a-time: TC
two at-a-time: GT
two at-a-time: CG
two at-a-time: AT
two at-a-time: GC
two at-a-time: TG
two at-a-time: AT
two at-a-time: GC
two at-a-time: TA
two at-a-time: GC
two at-a-time: CC
two at-a-time: C
six at-a-time: AGTCGT
six at-a-time: CGATGC
six at-a-time: TGATGC
six at-a-time: TAGCCC
six at-a-time: C

-Blake

[particle]

there is something magical about split. when used as my @chars = split //, $word;, it will split on each character, including a null field for each leading whitespace character. when used as my @chars = split '', $word;, it will split on each character without creating leading null fields.

this may not be applicable to your data, but i thought it's something you would want to know.

~Particle

[hopes]

Just one alternative chunk of code, without using split:
You can use unpack and obtain one array which contains the ascii values of the strings:

unpack "C*",$str

And you can obtain the chars as follow


@a=map chr,unpack "C*",$str;



Hopes


$_=$,=q,\,@4O,,s,^$,$\,,s,s,^,b9,s,
$_^=q,$\^-]!,,print