Base sequence length in fasta format file

[lolly]

Hi, i am stuck. i have a file which contains various stretches of DNA in fasta format e.g

>12343
ACTAGCTAGCTGATGTCGTCCTACACAT

>4567465
ACTAGCGGCGTGCCTAGTACGTACTTCTTG

in which each record is separated by a newline. I am trying to write code that will return all sequences containing more than 250 bases. But i think i am getting confused with nested loops etc because although my program runs fine it still returns everything. can anyone help?? this is my code:

#! /usr/local/bin/perl -w

use strict;

open (INPUT, $ARGV[0]) or die "unable to open file";

my $sequence;
my $count =0;
my $base = ("A"|"C"|"G"|"T");
my @array;
my $ideal = 250;

while (<INPUT>)
{
$sequence = $_;
@array = ();
@array = split (/\n/, $sequence);

foreach $base ($sequence)
{
$count++;

if ($count > $ideal)
{
print "$base\n";
}
}
}

i am new to perl and would appreciate any help. lolly