Beefy Boxes and Bandwidth Generously Provided by pair Networks
Come for the quick hacks, stay for the epiphanies.
 
PerlMonks  

comment on

( [id://3333]=superdoc: print w/replies, xml ) Need Help??

INPUT

ORIGIN

1 ccctaaaccc taaaccctaa accctaaacc ctaaacccta aaccctaaac cctaaaccct

61 aaaccctaaa ccctaaaccc taaaccctaa accctaaacc ctaaacccta aaccctaaac

121 cctaaaccct aaaccctaaa cgatgcatta ctactcacac gaacgagtga atgaaacaca

//
if ($line =~ /^$begin/) #$begin="ORIGIN"; { &body;} sub body { while ($line = <IN>) { chomp ($line); if ($line !~ /^$end/) { #$end =" \/\/" $line =~ s/[0-9]//g; # $line =~ s/\s+//g; # $line =~ s/\n//g; chomp ($line); #$line =~ /([atcgn]+)/g; print OUT "Genome: \n $line\n"; } else { last; } } }
OUTPUT:

Genome: ccctaaaccc taaaccctaa accctaaacc ctaaacccta aaccctaaac cctaaaccct

Genome: aaaccctaaa ccctaaaccc taaaccctaa accctaaacc ctaaacccta aaccctaaac

Genome: cctaaaccct aaaccctaaa cgatgcatta ctactcacac gaacgagtga atgaaacaca

EXPECTED:

Genome: ccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccct aaaccctaaacgatgcattactactcacacgaacgagtgaatgaaacaca

QUESTION: how could I escape new line? I tried \n substitution, \W.. or whatever else, but anyway it does not disappear.

In reply to how to escape new line in a string by nica

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post; it's "PerlMonks-approved HTML":



  • Are you posting in the right place? Check out Where do I post X? to know for sure.
  • Posts may use any of the Perl Monks Approved HTML tags. Currently these include the following:
    <code> <a> <b> <big> <blockquote> <br /> <dd> <dl> <dt> <em> <font> <h1> <h2> <h3> <h4> <h5> <h6> <hr /> <i> <li> <nbsp> <ol> <p> <small> <strike> <strong> <sub> <sup> <table> <td> <th> <tr> <tt> <u> <ul>
  • Snippets of code should be wrapped in <code> tags not <pre> tags. In fact, <pre> tags should generally be avoided. If they must be used, extreme care should be taken to ensure that their contents do not have long lines (<70 chars), in order to prevent horizontal scrolling (and possible janitor intervention).
  • Want more info? How to link or How to display code and escape characters are good places to start.
Log In?
Username:
Password:

What's my password?
Create A New User
Domain Nodelet?
Chatterbox?
and the web crawler heard nothing...

How do I use this?Last hourOther CB clients
Other Users?
Others sharing their wisdom with the Monastery: (6)
As of 2024-04-25 07:18 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    No recent polls found