Beefy Boxes and Bandwidth Generously Provided by pair Networks
more useful options
 
PerlMonks  

comment on

( #3333=superdoc: print w/replies, xml ) Need Help??

INPUT

ORIGIN

1 ccctaaaccc taaaccctaa accctaaacc ctaaacccta aaccctaaac cctaaaccct

61 aaaccctaaa ccctaaaccc taaaccctaa accctaaacc ctaaacccta aaccctaaac

121 cctaaaccct aaaccctaaa cgatgcatta ctactcacac gaacgagtga atgaaacaca

//
if ($line =~ /^$begin/) #$begin="ORIGIN"; { &body;} sub body { while ($line = <IN>) { chomp ($line); if ($line !~ /^$end/) { #$end =" \/\/" $line =~ s/[0-9]//g; # $line =~ s/\s+//g; # $line =~ s/\n//g; chomp ($line); #$line =~ /([atcgn]+)/g; print OUT "Genome: \n $line\n"; } else { last; } } }
OUTPUT:

Genome: ccctaaaccc taaaccctaa accctaaacc ctaaacccta aaccctaaac cctaaaccct

Genome: aaaccctaaa ccctaaaccc taaaccctaa accctaaacc ctaaacccta aaccctaaac

Genome: cctaaaccct aaaccctaaa cgatgcatta ctactcacac gaacgagtga atgaaacaca

EXPECTED:

Genome: ccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccct aaaccctaaacgatgcattactactcacacgaacgagtgaatgaaacaca

QUESTION: how could I escape new line? I tried \n substitution, \W.. or whatever else, but anyway it does not disappear.

In reply to how to escape new line in a string by nica

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post; it's "PerlMonks-approved HTML":



  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.
  • Log In?
    Username:
    Password:

    What's my password?
    Create A New User
    Chatterbox?
    and the web crawler heard nothing...

    How do I use this? | Other CB clients
    Other Users?
    Others lurking in the Monastery: (8)
    As of 2020-07-13 09:02 GMT
    Sections?
    Information?
    Find Nodes?
    Leftovers?
      Voting Booth?

      No recent polls found

      Notices?