in reply to Re: non-exact regexp matches
in thread non-exact regexp matches
Hi,
I tested your program on the following sequence:
I'm looking over your regexp... bu it'll take me a while to figure it out. Thanks for the help. VinceACCAACCGGATTCTAGATGCAGATGTTGAAGATT # works OK. Change the second C for a G: AGCAACCGGATTCTAGATGCAGATGTTGAAGATT # Doesn't work.
In Section
Seekers of Perl Wisdom