in reply to simple perl script to trim a FASTA file
trim off x nucleotides from the beginning, and y nucleotides from the end
#!/usr/bin/perl while (<DATA>) { s/^(?!>)...(.*)..../$1/; # ^^^ ^^^^ # x=3 y=4 print; } __DATA__ >HWI-EAS158_40_3_1_46_535 GTGAATGCGTGATACAGGAATGTTCGTTGTGACCAT >HWI-EAS158_40_3_1_47_579 AAAGTGAATGCGTGATACAGGAATGTTCGTTGTGAC >HWI-EAS158_40_3_1_46_731 GTGTCATGCGTGATACAGGAATGTTCGTTGTGAAAA
For longer stretches you can also write .{N} (with N being the number of nucleotides to trim).
|
---|
In Section
Seekers of Perl Wisdom