Beefy Boxes and Bandwidth Generously Provided by pair Networks
Your skill will accomplish
what the force of many cannot
 
PerlMonks  

Re: regular expression questions (from someone without experience)

by thargas (Deacon)
on Sep 22, 2010 at 13:20 UTC ( #861272=note: print w/replies, xml ) Need Help??


in reply to regular expression questions (from someone without experience)

I'm not a biology guy, but when I see strings like TGGACGGAGAACTGATAAGGGT in a file I think DNA/RNA. Have you looked in CPAN? There are lots of modules there specific to things biological. I.E. you may be re-inventing an existing wheel.
  • Comment on Re: regular expression questions (from someone without experience)

Replies are listed 'Best First'.
Re^2: regular expression questions (from someone without experience)
by BioLion (Curate) on Sep 22, 2010 at 15:24 UTC

    This certianly looks like a standard output format - maybe OP should also check out BioPerl...

    Just a something something...

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://861272]
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others surveying the Monastery: (9)
As of 2020-05-28 11:56 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?
    If programming languages were movie genres, Perl would be:















    Results (165 votes). Check out past polls.

    Notices?