Beefy Boxes and Bandwidth Generously Provided by pair Networks
There's more than one way to do things
 
PerlMonks  

Comment on

( #3333=superdoc: print w/replies, xml ) Need Help??
Hello Friends!!!
What is the best way to pattern match an unknown pattern? Allow me to explain... I have a file that contains a series of data values (microarray probe sets to be specific) that I need to sort through. Technically, there should be 11 "probes" for each target (ex. 154115_at=target name), but there are not. So, since there is a commonality between these probes (the target name), I need to be able to sort through the file and have the program take the target name value from the first line, compare it to succesive lines until one doesn't match. (The matching data needs to be further parsed and put on one line tab delimited, but I know how to do that.)When that occurs, the mismatched data needs to become the new pattern to be compared to. I'm familiar with pattern matching. However, I don't know how to designate an "unknown" pattern in perl, since I can't go and write 22,000 some-odd patterns:-). A sample imput file:
>probe:MOE430A:1415670_at(target name):549:177; Interrogation_Position +=2436; Antisense; GGCTGATCACATCCAAAAAGTCATG(probe sequence) >probe:MOE430A:1415670_at:549:177; Interrogation_Position=2513; Antise +nse; GAGGAAACGTTCACCCTGTCTACTA >probe:MOE430A:1415670_at:467:433; Interrogation_Position=2521; Antise +nse; GTTCACCCTGTCTACTATCAAGACA >probe:MOE430A:1415670_at:254:643; Interrogation_Position=2533; Antise +nse; TACTATCAAGACACTCGAAGAGGCT >probe:MOE430A:1415670_at:54:269; Interrogation_Position=2556; Antisen +se; CTGTGGGCAATATTGTGAAGTTCCT >probe:MOE430A:1415670_at:405:339; Interrogation_Position=2583; Antise +nse; GAATGCATCCTTGTGAGAGGTCAGA >probe:MOE430A:1415670_at:60:395; Interrogation_Position=2597; Antisen +se; GAGAGGTCAGACAAAGTGCCAGAAA >probe:MOE430A:1415670_at:284:165; Interrogation_Position=2619; Antise +nse; AAAACAAGAACACCCACACGCTGCT >probe:MOE430A:1415670_at:622:145; Interrogation_Position=2634; Antise +nse; ACACGCTGCTGCTAGCTGGAGTATT >probe:MOE430A:1415670_at:291:661; Interrogation_Position=2804; Antise +nse; TATCTTGTCCAACACTACGTCGAAG >probe:MOE430A:1415670_at:146:701; Interrogation_Position=2956; Antise +nse; TTGTCACCATGCCTGCAAGGAGAGA >probe:MOE430A:1415671_at:116:525; Interrogation_Position=1156; Antise +nse; GGAACAGGAATGTCGCAACATCGTA >probe:MOE430A:1415671_at:655:137; Interrogation_Position=1173; Antise +nse; ACATCGTATGGATTGCTGAGTGCAT >probe:MOE430A:1415671_at:398:139; Interrogation_Position=1232; Antise +nse;
Any help is most appreciated!
Bioinformatics

In reply to Little pattern problem... by bioinformatics

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post; it's "PerlMonks-approved HTML":



  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.
  • Log In?
    Username:
    Password:

    What's my password?
    Create A New User
    Chatterbox?
    and the web crawler heard nothing...

    How do I use this? | Other CB clients
    Other Users?
    Others studying the Monastery: (5)
    As of 2018-09-24 23:00 GMT
    Sections?
    Information?
    Find Nodes?
    Leftovers?
      Voting Booth?
      Eventually, "covfefe" will come to mean:













      Results (195 votes). Check out past polls.

      Notices?
      • (Sep 10, 2018 at 22:53 UTC) Welcome new users!