Beefy Boxes and Bandwidth Generously Provided by pair Networks
Problems? Is your data what you think it is?
 
PerlMonks  

comment on

( #3333=superdoc: print w/replies, xml ) Need Help??
Have a look at Regex with variables?. From what I understood this might be what you need.
Cheers, CombatSquirrel.
Update: Or maybe in your case, the following might help as well:
#!perl use strict; use warnings; my ($curr, $probe, $target, $pos, $sense); for (<DATA>) { if (/>probe:(\w+):(\w+):\d+:\d+;\s+Interrogation_Position=(\d+);\s+ +(\w+);/) { ($probe, $target, $pos, $sense) = ($1, $2, $3, $4); if ($curr and $curr ne $target) { if ($curr) { ### do processing for mismatch here } $curr = $target; } else { $curr = $target if (!$curr); ### do processing for target here } } else { ### do processing for probe sequence here } } __DATA__ >probe:MOE430A:1415670_at:549:177; Interrogation_Position=2436; Antise +nse; GGCTGATCACATCCAAAAAGTCATG >probe:MOE430A:1415670_at:549:177; Interrogation_Position=2513; Antise +nse; GAGGAAACGTTCACCCTGTCTACTA >probe:MOE430A:1415670_at:467:433; Interrogation_Position=2521; Antise +nse; GTTCACCCTGTCTACTATCAAGACA >probe:MOE430A:1415670_at:254:643; Interrogation_Position=2533; Antise +nse; TACTATCAAGACACTCGAAGAGGCT >probe:MOE430A:1415670_at:54:269; Interrogation_Position=2556; Antisen +se; CTGTGGGCAATATTGTGAAGTTCCT >probe:MOE430A:1415670_at:405:339; Interrogation_Position=2583; Antise +nse; GAATGCATCCTTGTGAGAGGTCAGA >probe:MOE430A:1415670_at:60:395; Interrogation_Position=2597; Antisen +se; GAGAGGTCAGACAAAGTGCCAGAAA >probe:MOE430A:1415670_at:284:165; Interrogation_Position=2619; Antise +nse; AAAACAAGAACACCCACACGCTGCT >probe:MOE430A:1415670_at:622:145; Interrogation_Position=2634; Antise +nse; ACACGCTGCTGCTAGCTGGAGTATT >probe:MOE430A:1415670_at:291:661; Interrogation_Position=2804; Antise +nse; TATCTTGTCCAACACTACGTCGAAG >probe:MOE430A:1415670_at:146:701; Interrogation_Position=2956; Antise +nse; TTGTCACCATGCCTGCAAGGAGAGA >probe:MOE430A:1415671_at:116:525; Interrogation_Position=1156; Antise +nse; GGAACAGGAATGTCGCAACATCGTA >probe:MOE430A:1415671_at:655:137; Interrogation_Position=1173; Antise +nse; ACATCGTATGGATTGCTGAGTGCAT >probe:MOE430A:1415671_at:398:139; Interrogation_Position=1232; Antise +nse;

In reply to Re: Little pattern problem... by CombatSquirrel
in thread Little pattern problem... by bioinformatics

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post; it's "PerlMonks-approved HTML":



  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.
  • Log In?
    Username:
    Password:

    What's my password?
    Create A New User
    Chatterbox?
    and the web crawler heard nothing...

    How do I use this? | Other CB clients
    Other Users?
    Others perusing the Monastery: (4)
    As of 2020-05-29 14:04 GMT
    Sections?
    Information?
    Find Nodes?
    Leftovers?
      Voting Booth?
      If programming languages were movie genres, Perl would be:















      Results (169 votes). Check out past polls.

      Notices?