Is this sufficient?
#!/usr/bin/perl
use strict;
use warnings;
my(@codons)= qw(ATG GTG);
my $dna = "AAAATGGGGTAAGTGAACGGGTAA";
my $splitter= join('|', @codons);
my @sequences= split /($splitter)/,$dna;
shift @sequences;
my $codon= 1;
foreach (@sequences) {
if ($codon) {
print $_,"-";
}
else {
print $_,"\n"
}
$codon= not $codon;
}
output
ATG-GGGTAA
GTG-AACGGGTAA
it works by splitting at codons, but capturing them. Then discarding the first (possibly empty) ouput of split and putting together every two elements of split's output.
s$$([},&%#}/&/]+}%&{})*;#$&&s&&$^X.($'^"%]=\&(|?*{%
+.+=%;.#_}\&"^"-+%*).}%:##%}={~=~:.")&e&&s""`$''`"e
-
Are you posting in the right place? Check out Where do I post X? to know for sure.
-
Posts may use any of the Perl Monks Approved HTML tags. Currently these include the following:
<code> <a> <b> <big>
<blockquote> <br /> <dd>
<dl> <dt> <em> <font>
<h1> <h2> <h3> <h4>
<h5> <h6> <hr /> <i>
<li> <nbsp> <ol> <p>
<small> <strike> <strong>
<sub> <sup> <table>
<td> <th> <tr> <tt>
<u> <ul>
-
Snippets of code should be wrapped in
<code> tags not
<pre> tags. In fact, <pre>
tags should generally be avoided. If they must
be used, extreme care should be
taken to ensure that their contents do not
have long lines (<70 chars), in order to prevent
horizontal scrolling (and possible janitor
intervention).
-
Want more info? How to link
or How to display code and escape characters
are good places to start.
|