Beefy Boxes and Bandwidth Generously Provided by pair Networks
No such thing as a small change
 
PerlMonks  

comment on

( [id://3333]=superdoc: print w/replies, xml ) Need Help??

Is this sufficient?

#!/usr/bin/perl use strict; use warnings; my(@codons)= qw(ATG GTG); my $dna = "AAAATGGGGTAAGTGAACGGGTAA"; my $splitter= join('|', @codons); my @sequences= split /($splitter)/,$dna; shift @sequences; my $codon= 1; foreach (@sequences) { if ($codon) { print $_,"-"; } else { print $_,"\n" } $codon= not $codon; }

output

ATG-GGGTAA GTG-AACGGGTAA

it works by splitting at codons, but capturing them. Then discarding the first (possibly empty) ouput of split and putting together every two elements of split's output.


s$$([},&%#}/&/]+}%&{})*;#$&&s&&$^X.($'^"%]=\&(|?*{%
+.+=%;.#_}\&"^"-+%*).}%:##%}={~=~:.")&e&&s""`$''`"e

In reply to Re: Orf subsequences by Skeeve
in thread Orf subsequences by odegbon

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post; it's "PerlMonks-approved HTML":



  • Are you posting in the right place? Check out Where do I post X? to know for sure.
  • Posts may use any of the Perl Monks Approved HTML tags. Currently these include the following:
    <code> <a> <b> <big> <blockquote> <br /> <dd> <dl> <dt> <em> <font> <h1> <h2> <h3> <h4> <h5> <h6> <hr /> <i> <li> <nbsp> <ol> <p> <small> <strike> <strong> <sub> <sup> <table> <td> <th> <tr> <tt> <u> <ul>
  • Snippets of code should be wrapped in <code> tags not <pre> tags. In fact, <pre> tags should generally be avoided. If they must be used, extreme care should be taken to ensure that their contents do not have long lines (<70 chars), in order to prevent horizontal scrolling (and possible janitor intervention).
  • Want more info? How to link or How to display code and escape characters are good places to start.
Log In?
Username:
Password:

What's my password?
Create A New User
Domain Nodelet?
Chatterbox?
and the web crawler heard nothing...

How do I use this?Last hourOther CB clients
Other Users?
Others romping around the Monastery: (7)
As of 2024-04-19 07:48 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    No recent polls found