Re: regular expression questions (from someone without experience)

in reply to regular expression questions (from someone without experience)

I'm not a biology guy, but when I see strings like TGGACGGAGAACTGATAAGGGT in a file I think DNA/RNA. Have you looked in CPAN? There are lots of modules there specific to things biological. I.E. you may be re-inventing an existing wheel.

Comment on Re: regular expression questions (from someone without experience)

Replies are listed 'Best First'.
Re^2: regular expression questions (from someone without experience) by BioLion (Curate) on Sep 22, 2010 at 15:24 UTC
This certianly looks like a standard output format - maybe OP should also check out BioPerl... Just a something something...	[reply]

In Section Seekers of Perl Wisdom