Hi, i am stuck. i have a file which contains various stretches of DNA in fasta format e.g 
>12343
ACTAGCTAGCTGATGTCGTCCTACACAT

>4567465
ACTAGCGGCGTGCCTAGTACGTACTTCTTG

[download]
in which each record is separated by a newline. I am trying to write code that will return all sequences containing more than 250 bases. But i think i am getting confused with nested loops etc because although my program runs fine it still returns everything. can anyone help?? this is my code: 

#! /usr/local/bin/perl -w

use strict;

open (INPUT, $ARGV[0]) or die "unable to open file";

my $sequence;
my $count =0;
my $base = ("A"|"C"|"G"|"T");
my @array;
my $ideal = 250;

while (<INPUT>)
{
$sequence = $_;
@array = ();
@array = split (/\n/, $sequence);

foreach $base ($sequence)
{
$count++;

if ($count > $ideal)
{
print "$base\n";
}
}
}

[download]
i am new to perl and would appreciate any help. lolly

In reply to Base sequence length in fasta format file by lolly

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post; it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.