in reply to Re^2: Reading file into a hash
in thread Reading file into a hash

Thats a very common problem, you are trying to add a record only when the successor is to be parsed, but the last record has no successor (sic ;)!

Most people try to solve by repeating code to add the last record after the loop.

But it's much cleaner this way (avoiding a posteriori state logic)

use strict; use warnings; use Data::Dump; my $header; my %sequence; while ( my $line = <DATA> ){ chomp $line; if ( $line =~ /^>(.*)/ ) { $header = $1; } else { $sequence{$header} .= $line; } } dd \%sequence; __DATA__ >sequence_5849 CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCC TCCCACTAATAATTCTGAGG >sequence_5959 CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCT ATATCCATTTGTCAGCAGACACGC >sequence_0808 CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGAC TGGGAACCTGCGGGCAGTAGGTGGAAT
output
{ sequence_0808 => "CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGAC +CAGCCCGGACTGGGAACCTGCGGGCAGTAGGTGGAAT", sequence_5849 => "CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTC +CGGCCTTCCCTCCCACTAATAATTCTGAGG", sequence_5959 => "CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCG +CCGAAGGTCTATATCCATTTGTCAGCAGACACGC", }

Cheers Rolf

( addicted to the Perl Programming Language)

update

a *general pattern* to solve such problems while staying DRY is to use references

if ( $line =~ /^(HEAD_PATTERN)/ ) { $data = \ $deeply{nested}{structure}{$1}; # reference data + } else { $$data .= $line; # derefrence data }

like this you don't need to repeat the path of a deeply nested data structure, which might vary in multiple dimensions

update
added some explanation