how to escape new line in a string

nica has asked for the wisdom of the Perl Monks concerning the following question:

INPUT

ORIGIN

1 ccctaaaccc taaaccctaa accctaaacc ctaaacccta aaccctaaac cctaaaccct

61 aaaccctaaa ccctaaaccc taaaccctaa accctaaacc ctaaacccta aaccctaaac

121 cctaaaccct aaaccctaaa cgatgcatta ctactcacac gaacgagtga atgaaacaca

 
if ($line =~ /^$begin/) #$begin="ORIGIN";
    { &body;}
sub body 
{ 
    while ($line = <IN>) 
    {
        chomp ($line); 
         
        if ($line !~ /^$end/) 
        { #$end =" \/\/"
            $line =~ s/[0-9]//g; # 
      
            $line =~ s/\s+//g; # 
        $line =~ s/\n//g;
        chomp ($line);
        #$line =~ /([atcgn]+)/g;
    print OUT "Genome: \n $line\n"; 
          }
        else 
        { last; }
        }
}
[download]

OUTPUT:

Genome: ccctaaaccc taaaccctaa accctaaacc ctaaacccta aaccctaaac cctaaaccct

Genome: aaaccctaaa ccctaaaccc taaaccctaa accctaaacc ctaaacccta aaccctaaac

Genome: cctaaaccct aaaccctaaa cgatgcatta ctactcacac gaacgagtga atgaaacaca

EXPECTED:

Genome: ccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccct aaaccctaaacgatgcattactactcacacgaacgagtgaatgaaacaca

QUESTION: how could I escape new line? I tried \n substitution, \W.. or whatever else, but anyway it does not disappear.

Comment on how to escape new line in a string Download Code

Replies are listed 'Best First'.

Re: how to escape new line in a string
by Athanasius (Archbishop) on Jun 16, 2019 at 08:37 UTC

Hello nica,

If you look carefully at this line:

print OUT "Genome: \n $line\n";
#                  ^^      ^^
[download]

you will see that you are adding the newlines yourself! Here is one approach that does what you want:

use strict;
use warnings;

print 'Genome: ';

while (my $line = <DATA>) 
{
    $line =~ s/^[0-9]+//;   # Remove initial digits
    $line =~ s/\s+//g;      # Remove all whitespace (including newline
+s)

    print $line if $line =~ /[acgt]+/;
}

print "\n";

__DATA__
INPUT

ORIGIN

1 ccctaaaccc taaaccctaa accctaaacc ctaaacccta aaccctaaac cctaaaccct

61 aaaccctaaa ccctaaaccc taaaccctaa accctaaacc ctaaacccta aaccctaaac

121 cctaaaccct aaaccctaaa cgatgcatta ctactcacac gaacgagtga atgaaacaca
[download]

Output:

18:35 >perl 2007_SoPW.pl
Genome: ccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaa
+accctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaacccta
+aaccctaaacgatgcattactactcacacgaacgagtgaatgaaacaca

18:35 >
[download]

Hope that helps,

Athanasius <°(((>< contra mundum Iustus alius egestas vitae, eros Piratica,

[reply]
[d/l]
[select]

Re: how to escape new line in a string
by haukex (Archbishop) on Jun 16, 2019 at 08:51 UTC

The output you showed does not match the output I get - your s/\s+//g; to remove all whitespace seems to be working fine. So it seems like the code you showed here does not match your input and/or output, please make sure to provide consistent examples. See How do I post a question effectively? and Short, Self-Contained, Correct Example. Also, please use <code> tags to format input and output in addition to your code.

Athanasius has pointed out that you are adding extra newlines to the output. Another important point here is that you are reading the input line-by-line, so that the print OUT "Genome: \n" happens on every line of input. What Athanasius's code is doing instead is printing the "Genome:" once, before all the data, and then printing the data with all newlines removed, which works because print does not add newlines to the output by default (that means print "a"; print "b"; print "c"; writes "abc" to the output one character at a time).

A couple more tips: I strongly recommend you clean up your formatting, that'll make it easier for you and for us to read your code - perltidy can help with that. Also, since I don't see the declaration of $line, make sure that you Use strict and warnings and only declare your variables at the smallest scope necessary (e.g. while ( my $line = <$in_fh> )). And one more nit: "escape" usually means to take a special character and turn it into plaintext, for example turning "\n" into "\\n" such that in the output, instead of a newline, you get two visible characters, \n. I think your question would be better described as "removing all newlines".

[reply]
[d/l]
[select]

Re: how to escape new line in a string
by james28909 (Deacon) on Jun 16, 2019 at 15:53 UTC

#using activestate perl 5.16.3

use strict;
use warnings;

s/^INPUT|^ORIGIN|\d|\s//g && print while(<DATA>); # '\s' finds newline
+s as well

__DATA__
INPUT

ORIGIN

1 ccctaaaccc taaaccctaa accctaaacc ctaaacccta aaccctaaac cctaaaccct

61 aaaccctaaa ccctaaaccc taaaccctaa accctaaacc ctaaacccta aaccctaaac

121 cctaaaccct aaaccctaaa cgatgcatta ctactcacac gaacgagtga atgaaacaca
[download]

OUTPUT:

C:\Users\James\Desktop\pm\>pm.pl
ccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaa
+ccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaaaccctaa
+acgatgcattactactcacacgaacgagtgaatgaaacaca
[download]

[reply]
[d/l]
[select]

Re: how to escape new line in a string
by karlgoethebier (Abbot) on Jun 16, 2019 at 19:00 UTC

I just wondered if the data you provided is really the original format. And has this format a name/standard? And printing "Genome" in the filtered output might be redundant. Best regards, Karl

ŤThe Crux of the Biscuit is the Apostropheť

perl -MCrypt::CBC -E 'say Crypt::CBC->new(-key=>'kgb',-cipher=>"Blowfish")->decrypt_hex($ENV{KARL});'Help

[reply]
[d/l]

Re: how to escape new line in a string
by betmatt (Scribe) on Jun 20, 2019 at 09:17 UTC

[reply]

Back to Seekers of Perl Wisdom