Beefy Boxes and Bandwidth Generously Provided by pair Networks
Perl: the Markov chain saw
 
PerlMonks  

comment on

( [id://3333]=superdoc: print w/replies, xml ) Need Help??
Hello nikkk. To answer your question, the problem is this line: $query = <>;. The diamond operator, <> opens a file supplied in the command line (contained in @ARGV, so $query now contains the first line from that file. There are 2 ways I can think of to avoid this.

First, you can change that line to $query = <STDIN>; and the program will read what you type in instead of doing the magic of reading from the file contained in @ARGV.

Second, you could empty the @ARGV array at the top of your program by saying $nomefile = shift @ARGV;. shift would remove the first (and in your case the only) filename from the command line and that would solve the problem when using the empty diamond <> operator later in the program.

Even though the second method would solve your problem, it is probably still better to use <STDIN> when reading a response from the command line anyway. That way, you will avoid any problems in your program.

I tried to understand what your program does and attempted to solve it using the Bio::SeqIO module which provides a good way to deal with fasta files. Documentation for BioPerl is here.

My example program and sample fasta data file are below.

Update: Changed program to process data as read (instead of storing to a data structure to process afterwards).
#usr/bin/perl use strict; use warnings; use Bio::SeqIO; # 'shift' removes items from @ARGV my $nomefile = shift; print "Insert query:\n"; chomp(my $query = uc <STDIN>); my $test = Bio::SeqIO->new( -file => $nomefile, -format => 'fasta'); print "\nResults for $nomefile\n\n"; while (my $seq = $test->next_seq()) { my @pos; my $id = $seq->id; my $fasta = uc $seq->seq; while ($fasta =~ /(?=$query)/g) { push @pos, $-[0] + 1; } if (@pos) { printf "%s compare %d volte in posizione @pos with ID %s\n", $query, scalar @pos, $id; } else { print "$query does not appear in the sequence with ID $id\n"; + } }
The data file I tested with was:
>chr1 AACCCCCCCCTCCCCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGC CAAACCCCAAAAACAAAGAACCCTAACACCAGCCTAACCAGATTTCAAAT TTTATCTTTAGGCGGTATGCACTTTTAACAAAAAANNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN GCCCATCCTACCCAGCACACACACACCGCTGCTAACCCCATACCCCGAAC CAACCAAACCCCAAAGACACCCCCCACAGTTTATGTAGCTTACCTCNNNN >chrM GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCAT TTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTG GAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATT CTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACATACCTACTA AAGTGTGTTAATTAATTAATGCTTGTAGGACATAATAATAACAATTGAAT GTCTGCACAGCCGCTTTCCACACAGACATCATAACAAAANAATTTCCACC
Output I got from this sample data in response to the query was:
Insert query: tatt TATT does not appear in the sequence with ID chr1 TATT compare 5 volte in posizione 20 55 152 155 177 with ID chrM

I hope this helps answer your question. If you don't understand some of the code I wrote, ask and I'll try to explain. There are probably some new things there that you may not have seen yet.


In reply to Re: Question: homemade blat: insert query from keyboard to find an oligo in an hashtable by Cristoforo
in thread Question: homemade blat: insert query from keyboard to find an oligo in an hashtable by nikkk

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post; it's "PerlMonks-approved HTML":



  • Are you posting in the right place? Check out Where do I post X? to know for sure.
  • Posts may use any of the Perl Monks Approved HTML tags. Currently these include the following:
    <code> <a> <b> <big> <blockquote> <br /> <dd> <dl> <dt> <em> <font> <h1> <h2> <h3> <h4> <h5> <h6> <hr /> <i> <li> <nbsp> <ol> <p> <small> <strike> <strong> <sub> <sup> <table> <td> <th> <tr> <tt> <u> <ul>
  • Snippets of code should be wrapped in <code> tags not <pre> tags. In fact, <pre> tags should generally be avoided. If they must be used, extreme care should be taken to ensure that their contents do not have long lines (<70 chars), in order to prevent horizontal scrolling (and possible janitor intervention).
  • Want more info? How to link or How to display code and escape characters are good places to start.
Log In?
Username:
Password:

What's my password?
Create A New User
Domain Nodelet?
Chatterbox?
and the web crawler heard nothing...

How do I use this?Last hourOther CB clients
Other Users?
Others having an uproarious good time at the Monastery: (6)
As of 2024-03-29 11:16 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    No recent polls found