Beefy Boxes and Bandwidth Generously Provided by pair Networks
Think about Loose Coupling
 
PerlMonks  

comment on

( [id://3333]=superdoc: print w/replies, xml ) Need Help??
Pre-sorting the data seems like good advice to me,

It is quite the opposite of good advice. Ie very bad advice.

  1. Sorting is O(N logN). The OPs described processing is O(N).

    Sorting does not help the OPs processing at all.

  2. FASTA file are multi-line record format files.

    If you sorted a FASTA file with the system sort utility, it would screw the file up in a completely irrecoverable way.

    Eg. This:

    c:\test>type 845226.fasta >uc002yje.1 chr21:13973492-13976330 cccctgccccaccgcaccctggattactgcacgccaagaccctcacctga acgcgccctacactctggcatgggggaacccggccccgcagagccctgga CTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG >uc002yje.1 chr21:13973492-13976330 cccctgccccaccgcaccctggattactgcacgccaagaccctcacctga acgcgccctacactctggcatgggggaaaaaacccggccccgcagagccctgga CTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG >uc002yje.1 chr21:13973492-13976330 cccctgccccaccgcaccctggattactgcacgccaagaccctcacctga acgcgccctacactctggcatgggggaacccggccccgcagagggccctgga CTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG

    becomes this:

    c:\test>sort 845226.fasta >uc002yje.1 chr21:13973492-13976330 >uc002yje.1 chr21:13973492-13976330 >uc002yje.1 chr21:13973492-13976330 acgcgccctacactctggcatgggggaaaaaacccggccccgcagagccctgga acgcgccctacactctggcatgggggaacccggccccgcagagccctgga acgcgccctacactctggcatgggggaacccggccccgcagagggccctgga cccctgccccaccgcaccctggattactgcacgccaagaccctcacctga cccctgccccaccgcaccctggattactgcacgccaagaccctcacctga cccctgccccaccgcaccctggattactgcacgccaagaccctcacctga CTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG CTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG CTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG

    And so is rendered entirely useless.


Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
"Science is about questioning the status quo. Questioning authority".
In the absence of evidence, opinion is indistinguishable from prejudice.

In reply to Re^4: remove part of string (DNA) ... More off-topic by BrowserUk
in thread remove part of string (DNA) by Furor

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post; it's "PerlMonks-approved HTML":



  • Are you posting in the right place? Check out Where do I post X? to know for sure.
  • Posts may use any of the Perl Monks Approved HTML tags. Currently these include the following:
    <code> <a> <b> <big> <blockquote> <br /> <dd> <dl> <dt> <em> <font> <h1> <h2> <h3> <h4> <h5> <h6> <hr /> <i> <li> <nbsp> <ol> <p> <small> <strike> <strong> <sub> <sup> <table> <td> <th> <tr> <tt> <u> <ul>
  • Snippets of code should be wrapped in <code> tags not <pre> tags. In fact, <pre> tags should generally be avoided. If they must be used, extreme care should be taken to ensure that their contents do not have long lines (<70 chars), in order to prevent horizontal scrolling (and possible janitor intervention).
  • Want more info? How to link or How to display code and escape characters are good places to start.
Log In?
Username:
Password:

What's my password?
Create A New User
Domain Nodelet?
Chatterbox?
and the web crawler heard nothing...

How do I use this?Last hourOther CB clients
Other Users?
Others surveying the Monastery: (7)
As of 2024-04-23 16:32 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    No recent polls found