BLAST and BioPerl

[GeneticistDrew]

Hello all, I started to use Perl a couple a days ago and would like to ask my first question... I have been using BioPerl and all seems to be OK, however I cannot use StandAloneBlast. I've followed "http://www.bioperl.org/wiki/HOWTO:Beginners" down to BLAST, which I have installed as instructed on "http://www.ncbi.nlm.nih.gov/books/NBK52637/" but this is where the problems begin. To put it simply, I don’t know how to use/install NCBI Blast for use with BioPerl. I put a sequence database "Anopheles-gambiae-PEST_TRANSCRIPTS_AgamP3.7.fa" into the “db” folder of “blast-2.2.28+”. I then attempted to use the BLAST tool to find a specific DNA sequence within my database, as instructed on the bioperl beginners page.

#!/bin/perl -w
use warnings;
use Bio::Seq;
use Bio::Tools::Run::StandAloneBlast;
 
$blast_obj = Bio::Tools::Run::StandAloneBlast->new(-program  => 'blast
+n', -database => 'Anopheles-gambiae-PEST_TRANSCRIPTS_AgamP3.7.fa');
 
$seq_obj = Bio::Seq->new(-id  =>"AGAP007280_query", -seq =>"TCTCGAGATG
+GCGAACCTGCTGCAGGGGTTCAGCGAGATGGGTCCAGCCAAAGAGAAGACGACGCCACAGTATGAGG")
+;
 
$report_obj = $blast_obj->blastall($seq_obj);
 
$result_obj = $report_obj->next_result;
 
print $result_obj->num_hits;

The output is as follows:

Replacement list is longer than search list at C:/Dwimperl/perl/site/l
+ib/Bio/Ran
ge.pm line 251.
Use of uninitialized value $_[0] in string eq at C:/Dwimperl/perl/lib/
+File/Spec/
Win32.pm line 152.

--------------------- WARNING ---------------------
MSG: cannot find path to blastall
---------------------------------------------------
Can't call method "next_result" on an undefined value at bioperl_blast
+2.pl line
12.

I don't know how to define the path to blastall, which for the moment is probably the biggest issue. I’m not sure if I have been very clear, but I’m very new to this… thanks in advance!

[choroba]

Please, remove <br> from your code samples, it is not needed here.

You are using strict. While it is good and praiseworthy, it also means you have to follow its rules. One of the rules is "do not use a variable without declaring it first". None of your variables seem to be declared (see my).

[runrig]

You are using strict.

Unless the post was updated, no, the OP is not using strict. Both '-w' and 'use warnings' are being used (where only one or the other should be used...I prefer 'use warnings').

[choroba]

Yes, the post was updated, not following the advice given in How do I change/delete my post?. strict was removed and the errors are now completely different.

[ww]

The messages you've quoted do NOT support your supposition that "the problem is that it needs to use the NCBI BLAST installed components, which it cannot find." They address themselves solely to what choroba pointed out: that the first use of each needs to be declared with a "my" as, for one possibility,


my ($blast_obj, $seq_obj, $report_obj, $result_obj);

If Perl couldn't find something you tried to use, it would have provided an additional message specifically stating that it can't find it (by name).

[glasswalk3r]

I would also recommend reading How do I post a question effectively? and use <readmore> tags around the parts that could be omitted while previewing the post.